Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FABP4 cdna clone

FABP4 cDNA Clone

Gene Names
FABP4; aP2; ALBP; AFABP; A-FABP; HEL-S-104
Synonyms
FABP4; FABP4 cDNA Clone; FABP4 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgtgatgcttttgtaggtacctggaaacttgtctccagtgaaaactttgatgattatatgaaagaagtaggagtgggctttgccaccaggaaagtggctggcatggccaaacctaacatgatcatcagtgtgaatggggatgtgatcaccattaaatctgaaagtacctttaaaaatactgagatttccttcatactgggccaggaatttgacgaagtcactgcagatgacaggaaagtcaagagcaccataaccttagatgggggtgtcctggtacatgtgcagaaatgggatggaaaatcaaccaccataaagagaaaacgagaggatgataaactggtggtggaatgcgtcatgaaaggcgtcacttccacgagagtttatgagagagcataa
Sequence Length
399
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,719 Da
NCBI Official Full Name
Homo sapiens fatty acid binding protein 4, adipocyte, mRNA
NCBI Official Synonym Full Names
fatty acid binding protein 4
NCBI Official Symbol
FABP4
NCBI Official Synonym Symbols
aP2; ALBP; AFABP; A-FABP; HEL-S-104
NCBI Protein Information
fatty acid-binding protein, adipocyte
UniProt Protein Name
Fatty acid-binding protein, adipocyte
UniProt Gene Name
FABP4
UniProt Synonym Gene Names
ALBP; A-FABP; AFABP
UniProt Entry Name
FABP4_HUMAN

NCBI Description

FABP4 encodes the fatty acid binding protein found in adipocytes. Fatty acid binding proteins are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. [provided by RefSeq, Jul 2008]

Uniprot Description

FABP4: a lipid transport protein that is the predominant fatty acid binding protein found in adipocytes. Also expressed in macrophages. Binds both long chain fatty acids and retinoic acid. Delivers long-chain fatty acids and retinoic acid to their cognate receptors in the nucleus. Homodimer. Forms a beta-barrel structure that accommodates hydrophobic ligands in its interior. Interacts with PPARG. Monomer. FABP4 knockout mice fed a high-fat and high-calorie diet become obese but develop neither insulin resistance nor diabetes, suggesting that this protein might be a link between obesity and insulin resistance and diabetes. Mice deficient in both FABP4 and ApoE show protection against atherosclerosis when compared with mice deficient only in ApoE. Mice carrying a FABP4 genetic variant exhibit both reduced FABP4 expression and a reduced potential for developing type 2 diabetes and coronary heart disease. A related study in humans indicated a similar pattern, suggesting that FABP4 may be a potential therapeutic target in the treatment of these disorders. Belongs to the calycin superfamily,fatty-acid binding protein (FABP) family.

Protein type: Lipid-binding

Chromosomal Location of Human Ortholog: 8q21

Cellular Component: cytoplasm; cytosol; lipid particle

Biological Process: triacylglycerol catabolic process

Research Articles on FABP4

Similar Products

Product Notes

The FABP4 fabp4 (Catalog #AAA1267998) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgtgatg cttttgtagg tacctggaaa cttgtctcca gtgaaaactt tgatgattat atgaaagaag taggagtggg ctttgccacc aggaaagtgg ctggcatggc caaacctaac atgatcatca gtgtgaatgg ggatgtgatc accattaaat ctgaaagtac ctttaaaaat actgagattt ccttcatact gggccaggaa tttgacgaag tcactgcaga tgacaggaaa gtcaagagca ccataacctt agatgggggt gtcctggtac atgtgcagaa atgggatgga aaatcaacca ccataaagag aaaacgagag gatgataaac tggtggtgga atgcgtcatg aaaggcgtca cttccacgag agtttatgag agagcataa. It is sometimes possible for the material contained within the vial of "FABP4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.