Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRKCSH cdna clone

PRKCSH cDNA Clone

Gene Names
PRKCSH; GIIB; PCLD; PLD1; G19P1; PCLD1; PKCSH; AGE-R2; VASAP-60
Synonyms
PRKCSH; PRKCSH cDNA Clone; PRKCSH cdna clone
Ordering
For Research Use Only!
Sequence
atggccgaggtcacccgcgaagggttccgtctgaagaagatccttattgaggactggaagaaggcacgggaggagaagcagaaaaagctcattgagctacaggctgggaagaagtctctggaagaccaggtggagatgctgcggacagtgaaggaggaagctgagaagccagagagagaggccaaagagcagcaccagaagctgtgggaagagcagctggctgctgccaaggcccaacaggagcaggagctggcggctgatgccttcaaggagctggatgatgacatggacgggacggtctcggtgactgagctgcagactcacccggagctggacacagatggggatggggcgttgtcagaagcggaagctcaggccctcctcagtggggacacacagacagacgccacctctttctacgaccgcgtctgggccgccatcagggacaagtaccggtccgaggcactgcccaccgaccttccaacaccttctgcccctgacttgacggagcccaaggaggagcagccgccagtgccctcgtcgcccacagaggaggaggaggaggaggaggaggaggaagaagaggctgaagaagaggaggaggaggaggattccgaggaggccccaccgccactgtcacccccgcagccggccagccctgctgaggaagacaaaatgccgccctacgacgagcagacgcaggccttcatcgatgctgcccaggaggcccgcaacaagttcgaggaggccgagcggtcgctgaaggacatggaggagtccatcaggaacctggagcaagagatttcttttgactttggccccaacggggagtttgcttacctgtacagccagtgctacgagctcaccaccaacgaatacgtctaccgcctctgccccttcaagcttgtctcgcagaaacccaaactcgggggctctcccaccagccttggcacctggggctcatggattggccccgaccacgacaagttcagtgccatgaagtatgagcaaggcacgggctgctggcagggccccaaccgctccaccaccgtgcgcctcctgtgcgggaaagagaccatggtgaccagcaccacagagcccagtcgctgcgagtacctcatggagctgatgacgccagccgcctgcccggagccaccgcctgaagcacccaccgaagacgaccatgacgagctctag
Sequence Length
1197
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,178 Da
NCBI Official Full Name
Homo sapiens protein kinase C substrate 80K-H, mRNA
NCBI Official Synonym Full Names
protein kinase C substrate 80K-H
NCBI Official Symbol
PRKCSH
NCBI Official Synonym Symbols
GIIB; PCLD; PLD1; G19P1; PCLD1; PKCSH; AGE-R2; VASAP-60
NCBI Protein Information
glucosidase 2 subunit beta
UniProt Protein Name
Glucosidase 2 subunit beta
Protein Family
UniProt Gene Name
PRKCSH
UniProt Synonym Gene Names
G19P1; PKCSH
UniProt Entry Name
GLU2B_HUMAN

NCBI Description

This gene encodes the beta-subunit of glucosidase II, an N-linked glycan-processing enzyme in the endoplasmic reticulum. The encoded protein is an acidic phosphoprotein known to be a substrate for protein kinase C. Mutations in this gene have been associated with the autosomal dominant polycystic liver disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]

Uniprot Description

PRKCSH: Regulatory subunit of glucosidase II. Defects in PRKCSH are a cause of polycystic liver disease (PCLD). PCLD is an autosomal dominant disorder and is characterized by the presence of multiple liver cysts of biliary epithelial origin. PCLD is a distinct clinical and genetic entity that can occur independently from autosomal dominant polycystic kidney disease (ADPKD), which in a considerable but uncertain proportion of cases is associated with hepatic cysts. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 19p13.2

Cellular Component: endoplasmic reticulum; endoplasmic reticulum lumen

Molecular Function: phosphoprotein binding; protein kinase C binding

Biological Process: protein folding

Disease: Polycystic Liver Disease

Research Articles on PRKCSH

Similar Products

Product Notes

The PRKCSH prkcsh (Catalog #AAA1267935) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgagg tcacccgcga agggttccgt ctgaagaaga tccttattga ggactggaag aaggcacggg aggagaagca gaaaaagctc attgagctac aggctgggaa gaagtctctg gaagaccagg tggagatgct gcggacagtg aaggaggaag ctgagaagcc agagagagag gccaaagagc agcaccagaa gctgtgggaa gagcagctgg ctgctgccaa ggcccaacag gagcaggagc tggcggctga tgccttcaag gagctggatg atgacatgga cgggacggtc tcggtgactg agctgcagac tcacccggag ctggacacag atggggatgg ggcgttgtca gaagcggaag ctcaggccct cctcagtggg gacacacaga cagacgccac ctctttctac gaccgcgtct gggccgccat cagggacaag taccggtccg aggcactgcc caccgacctt ccaacacctt ctgcccctga cttgacggag cccaaggagg agcagccgcc agtgccctcg tcgcccacag aggaggagga ggaggaggag gaggaggaag aagaggctga agaagaggag gaggaggagg attccgagga ggccccaccg ccactgtcac ccccgcagcc ggccagccct gctgaggaag acaaaatgcc gccctacgac gagcagacgc aggccttcat cgatgctgcc caggaggccc gcaacaagtt cgaggaggcc gagcggtcgc tgaaggacat ggaggagtcc atcaggaacc tggagcaaga gatttctttt gactttggcc ccaacgggga gtttgcttac ctgtacagcc agtgctacga gctcaccacc aacgaatacg tctaccgcct ctgccccttc aagcttgtct cgcagaaacc caaactcggg ggctctccca ccagccttgg cacctggggc tcatggattg gccccgacca cgacaagttc agtgccatga agtatgagca aggcacgggc tgctggcagg gccccaaccg ctccaccacc gtgcgcctcc tgtgcgggaa agagaccatg gtgaccagca ccacagagcc cagtcgctgc gagtacctca tggagctgat gacgccagcc gcctgcccgg agccaccgcc tgaagcaccc accgaagacg accatgacga gctctag. It is sometimes possible for the material contained within the vial of "PRKCSH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.