Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SPATA7 cdna clone

SPATA7 cDNA Clone

Gene Names
SPATA7; HSD3; LCA3; HSD-3.1; HEL-S-296
Synonyms
SPATA7; SPATA7 cDNA Clone; SPATA7 cdna clone
Ordering
For Research Use Only!
Sequence
atgacagattcagaaatgaacataaagcaggcatctaattgtgtgacatatgatgccaaagaaaaaatagctcctttacctttagaagggcatgactcaacatgggatgagattaaggatgatgctcttcagcattcctcaccaagggcaatgtgtcagtattccctgaagcccccttcaactcgtaaaatctactctgatgaagaagaactgttgtatctgagtttcattgaagatgtaacagatgaaattttgaaacttggtttattttcaaacaggtttttagaacgactgttcgagcgacatataaaacaaaataaacatttggaggaggaaaaaatgcgccacctgctgcatgtcctgaaagtagacttaggctgcacatcggaggaaaactcggtaaagcaaaatgatgttgatatgttgaatgtatttgattttgaaaaggctgggaattcagaaccaaatgaattaaaaaatgaaagtgaagtaacaattcagcaggaacgtcaacaataccaaaaggctttggatatgttattgtcggcaccaaaggatgagaacgagatattcccttcaccaactgaatttttcatgcctatttataaatcaaagcattcagaaggggttataattcaacaggtgaatgatgaaacaaatcttgaaacttcaactttggatgaaaatcatccaagtatttcagacagtttaacagatcgggaaacttctgtgaatgtcattgaaggtgatagtgaccctgaaaaggttgagatttcaaatggattatgtggtcttaacacatcaccctcccaatctgttcagttctccagtgtcaaaggcgacaataatcatgacatggagttatcaactcttaaaatcatggaaatgagcattgaggactgccctttggatgtttaa
Sequence Length
918
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,931 Da
NCBI Official Full Name
Homo sapiens spermatogenesis associated 7, mRNA
NCBI Official Synonym Full Names
spermatogenesis associated 7
NCBI Official Symbol
SPATA7
NCBI Official Synonym Symbols
HSD3; LCA3; HSD-3.1; HEL-S-296
NCBI Protein Information
spermatogenesis-associated protein 7
UniProt Protein Name
Spermatogenesis-associated protein 7
UniProt Gene Name
SPATA7
UniProt Synonym Gene Names
HSD3
UniProt Entry Name
SPAT7_HUMAN

NCBI Description

This gene, originally isolated from testis, is also expressed in retina. Mutations in this gene are associated with Leber congenital amaurosis and juvenile retinitis pigmentosa. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]

Uniprot Description

SPATA7: May be involved in retinal function. Defects in SPATA7 are the cause of Leber congenital amaurosis type 3 (LCA3). LCA designates a clinically and genetically heterogeneous group of childhood retinal degenerations, generally inherited in an autosomal recessive manner. Affected infants have little or no retinal photoreceptor function as tested by electroretinography. LCA represents the most common genetic cause of congenital visual impairment in infants and children. Defects in SPATA7 are a cause of retinitis pigmentosa autosomal recessive (ARRP). ARRP is a retinal dystrophy belonging to the group of pigmentary retinopathies. RP is characterized by retinal pigment deposits visible on fundus examination and primary loss of rod photoreceptor cells followed by secondary loss of cone photoreceptors. Patients typically have night vision blindness and loss of midperipheral visual field. As their condition progresses, they lose their far peripheral visual field and eventually central vision as well. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 14q31.3

Cellular Component: axoneme; microtubule cytoskeleton; photoreceptor connecting cilium

Molecular Function: protein binding

Biological Process: photoreceptor cell maintenance

Disease: Leber Congenital Amaurosis 3

Research Articles on SPATA7

Similar Products

Product Notes

The SPATA7 spata7 (Catalog #AAA1267798) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacagatt cagaaatgaa cataaagcag gcatctaatt gtgtgacata tgatgccaaa gaaaaaatag ctcctttacc tttagaaggg catgactcaa catgggatga gattaaggat gatgctcttc agcattcctc accaagggca atgtgtcagt attccctgaa gcccccttca actcgtaaaa tctactctga tgaagaagaa ctgttgtatc tgagtttcat tgaagatgta acagatgaaa ttttgaaact tggtttattt tcaaacaggt ttttagaacg actgttcgag cgacatataa aacaaaataa acatttggag gaggaaaaaa tgcgccacct gctgcatgtc ctgaaagtag acttaggctg cacatcggag gaaaactcgg taaagcaaaa tgatgttgat atgttgaatg tatttgattt tgaaaaggct gggaattcag aaccaaatga attaaaaaat gaaagtgaag taacaattca gcaggaacgt caacaatacc aaaaggcttt ggatatgtta ttgtcggcac caaaggatga gaacgagata ttcccttcac caactgaatt tttcatgcct atttataaat caaagcattc agaaggggtt ataattcaac aggtgaatga tgaaacaaat cttgaaactt caactttgga tgaaaatcat ccaagtattt cagacagttt aacagatcgg gaaacttctg tgaatgtcat tgaaggtgat agtgaccctg aaaaggttga gatttcaaat ggattatgtg gtcttaacac atcaccctcc caatctgttc agttctccag tgtcaaaggc gacaataatc atgacatgga gttatcaact cttaaaatca tggaaatgag cattgaggac tgccctttgg atgtttaa. It is sometimes possible for the material contained within the vial of "SPATA7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.