Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDC23 cdna clone

CDC23 cDNA Clone

Gene Names
CDC23; APC8; CUT23; ANAPC8
Synonyms
CDC23; CDC23 cDNA Clone; CDC23 cdna clone
Ordering
For Research Use Only!
Sequence
atggtcccggtggctgtgacggcggcagtggcgcctgtcctgtccataaacagcgatttctcagatttgcgggaaattaaaaagcaactgctgcttattgcgggccttacccgggagcggggcctactacacagtagcaaatggtcggcggagttggctttctctctccctgcattgcctctggccgagctgcaaccgcctccgcctattacagaggaagatgcccaggatatggatgcctataccctggccaaggcctactttgacgttaaagagtatgatcgggcagcacatttcctgcatggctgcaatagcaagaaagcctattttctgtatatgtattccagatatctgtctggagaaaaaaagaaggacgatgaaacagttgatagcttaggccccctggaaaaaggacaagtgaaaaatgaggcgcttagagaattgagagtggagctcagcaaaaaacaccaagctcgagaacttgatggatttggactttatctgtatggtgtggtgcttcgaaaactggacttggttaaagaggccattgatgtgtttgtggaagctactcatgttttgcccttgcattggggagcctggttagaactctgtaacctgatcacagacaaagagatgctgaagttcctgtctttgccagacacctggatgaaagagttttttctggctcatatatacacagagttgcagttgatagaggaggccctgcaaaagtatcagaatctcattgatgtgggcttctctaagagctcgtatattgtttcccaaattgcagttgcctatcacaatatcagagatattgacaaagccctctccatttttaatgagctaaggaaacaagacccttacaggattgaaaatatggacacattctccaaccttctttatgtcaggagcatgaaatcggagttgagttatctggctcataacctctgtgagattgataaatatcgtgtagaaacgtgctgtgtaattggcaattattacagtttacgttctcagcatgagaaagcagccttatatttccagagagccctgaaattaaatcctcggtatcttggtgcctggacactaatgggacatgagtacatggagatgaagaacacgtctgctgctatccaggcttatagacatgccattgaggtcaacaaacgggactacagagcttggtatggcctcgggcagacctatgaaatccttaagatgccattttactgcctttattattatagacgggcccaccagcttcgacccaatgattctcgcatgctggttgctttaggagaatgttacgagaaactcaatcaactagtggaagccaaaaagtgttattggagagcttacgccgtgggagatgtggagaaaatggctctggtgaaactggcaaagcttcatgaacagttgactgagtcagaacaggctgcccagtgttacatcaaatatatccaagatatctattcctgtggggaaatagtagaacacttggaggaaagcactgcctttcgctatctggcccagtactattttaagtgcaaactgtgggatgaagcttcaacttgtgcacaaaagtgttgtgcatttaatgatacccgggaagaaggtaaggccttactccggcaaatcctacagcttcggaaccaaggcgagactcctaccaccgaggtgcctgctccctttttcctacctgcttcactctctgctaacaatacccccacacgcagagtttctccactcaacttgtcttctgtcacgccatag
Sequence Length
1776
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,882 Da
NCBI Official Full Name
Homo sapiens cell division cycle 23 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
cell division cycle 23
NCBI Official Symbol
CDC23
NCBI Official Synonym Symbols
APC8; CUT23; ANAPC8
NCBI Protein Information
cell division cycle protein 23 homolog
UniProt Protein Name
Cell division cycle protein 23 homolog
UniProt Gene Name
CDC23
UniProt Synonym Gene Names
ANAPC8; APC8
UniProt Entry Name
CDC23_HUMAN

NCBI Description

The protein encoded by this gene shares strong similarity with Saccharomyces cerevisiae Cdc23, a protein essential for cell cycle progression through the G2/M transition. This protein is a component of anaphase-promoting complex (APC), which is composed of eight protein subunits and highly conserved in eukaryotic cells. APC catalyzes the formation of cyclin B-ubiquitin conjugate that is responsible for the ubiquitin-mediated proteolysis of B-type cyclins. This protein and 3 other members of the APC complex contain the TPR (tetratricopeptide repeat), a protein domain important for protein-protein interaction. [provided by RefSeq, Jul 2008]

Uniprot Description

CDC23: Component of the anaphase promoting complex/cyclosome (APC/C), a cell cycle-regulated E3 ubiquitin ligase that controls progression through mitosis and the G1 phase of the cell cycle. The APC/C complex acts by mediating ubiquitination and subsequent degradation of target proteins: it mainly mediates the formation of 'Lys-11'-linked polyubiquitin chains and, to a lower extent, the formation of 'Lys-48'- and 'Lys-63'-linked polyubiquitin chains. Belongs to the APC8/CDC23 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell cycle regulation

Chromosomal Location of Human Ortholog: 5q31

Cellular Component: anaphase-promoting complex; cytosol; intracellular; nucleoplasm

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; mitosis; mitotic metaphase plate congression; mitotic metaphase/anaphase transition; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of exit from mitosis; regulation of mitotic metaphase/anaphase transition; regulation of ubiquitin-protein ligase activity during mitotic cell cycle; ubiquitin-dependent protein catabolic process

Research Articles on CDC23

Similar Products

Product Notes

The CDC23 cdc23 (Catalog #AAA1267723) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtcccgg tggctgtgac ggcggcagtg gcgcctgtcc tgtccataaa cagcgatttc tcagatttgc gggaaattaa aaagcaactg ctgcttattg cgggccttac ccgggagcgg ggcctactac acagtagcaa atggtcggcg gagttggctt tctctctccc tgcattgcct ctggccgagc tgcaaccgcc tccgcctatt acagaggaag atgcccagga tatggatgcc tataccctgg ccaaggccta ctttgacgtt aaagagtatg atcgggcagc acatttcctg catggctgca atagcaagaa agcctatttt ctgtatatgt attccagata tctgtctgga gaaaaaaaga aggacgatga aacagttgat agcttaggcc ccctggaaaa aggacaagtg aaaaatgagg cgcttagaga attgagagtg gagctcagca aaaaacacca agctcgagaa cttgatggat ttggacttta tctgtatggt gtggtgcttc gaaaactgga cttggttaaa gaggccattg atgtgtttgt ggaagctact catgttttgc ccttgcattg gggagcctgg ttagaactct gtaacctgat cacagacaaa gagatgctga agttcctgtc tttgccagac acctggatga aagagttttt tctggctcat atatacacag agttgcagtt gatagaggag gccctgcaaa agtatcagaa tctcattgat gtgggcttct ctaagagctc gtatattgtt tcccaaattg cagttgccta tcacaatatc agagatattg acaaagccct ctccattttt aatgagctaa ggaaacaaga cccttacagg attgaaaata tggacacatt ctccaacctt ctttatgtca ggagcatgaa atcggagttg agttatctgg ctcataacct ctgtgagatt gataaatatc gtgtagaaac gtgctgtgta attggcaatt attacagttt acgttctcag catgagaaag cagccttata tttccagaga gccctgaaat taaatcctcg gtatcttggt gcctggacac taatgggaca tgagtacatg gagatgaaga acacgtctgc tgctatccag gcttatagac atgccattga ggtcaacaaa cgggactaca gagcttggta tggcctcggg cagacctatg aaatccttaa gatgccattt tactgccttt attattatag acgggcccac cagcttcgac ccaatgattc tcgcatgctg gttgctttag gagaatgtta cgagaaactc aatcaactag tggaagccaa aaagtgttat tggagagctt acgccgtggg agatgtggag aaaatggctc tggtgaaact ggcaaagctt catgaacagt tgactgagtc agaacaggct gcccagtgtt acatcaaata tatccaagat atctattcct gtggggaaat agtagaacac ttggaggaaa gcactgcctt tcgctatctg gcccagtact attttaagtg caaactgtgg gatgaagctt caacttgtgc acaaaagtgt tgtgcattta atgatacccg ggaagaaggt aaggccttac tccggcaaat cctacagctt cggaaccaag gcgagactcc taccaccgag gtgcctgctc cctttttcct acctgcttca ctctctgcta acaatacccc cacacgcaga gtttctccac tcaacttgtc ttctgtcacg ccatag. It is sometimes possible for the material contained within the vial of "CDC23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.