ZBTB32 cdna clone
ZBTB32 cDNA Clone
Gene Names
ZBTB32; Rog; FAXF; FAZF; TZFP; ZNF538
Synonyms
ZBTB32; ZBTB32 cDNA Clone; ZBTB32 cdna clone
Sequence
atgtccctgccccccataagactgcccagcccctatggctctgatcggctggtacagctagcagccaggctccggccagcactctgtgatactctgatcaccgtagggagccaggagttccccgcccacagcctggtgctagcaggtgtcagccagcagctgggccgcaggggccagtgggctctgggagaaggcatcagcccttctacctttgcccagctcctgaactttgtgtatggggagagtgtagagctgcagcctggagagctaaggccccttcaggaggcggccagggccttgggagtgcagtccctggaagaggcatgctggagggctcgaggggacagggctaaaaagccagatccaggcctgaagaaacatcaggaggagccagagaaaccctcaaggaatcctgagagagaactgggggaccctggagagaagcagaaaccagaacaggtttctagaactggtgggagagaacaggagatgttgcacaagcactcgccaccaagaggcagacccgagatggcaggagcaacgcaggaggctcagcaggaacagaccaggtcaaaggagaaacgcctccaagcccctgttggccaaaggggagcagatgggaagcatggagtgctcacgtggttgagggaaaatccagggggctctgaggaaagtctgcgcaagctccctggcccccttcccccagcaggctccctgcaaaccagcgtcacccctaggccctcgtgggctgaggccccttggttggtggggggccagcctgccctgtggagcatcctgctgatgccgcccagatatggcattcccttctaccatagcacccccaccactggagcctggcaggaggtctggcgggaacagaggcgcacttgcaacctgtgcgggtcatga
Sequence Length
909
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,963 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 32, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 32
NCBI Official Symbol
ZBTB32
NCBI Official Synonym Symbols
Rog; FAXF; FAZF; TZFP; ZNF538
NCBI Protein Information
zinc finger and BTB domain-containing protein 32
UniProt Protein Name
Zinc finger and BTB domain-containing protein 32
Protein Family
UniProt Gene Name
ZBTB32
UniProt Synonym Gene Names
FAZF; TZFP; ZNF538
UniProt Entry Name
ZBT32_HUMAN
Uniprot Description
ZBTB32: DNA-binding protein that binds to the to a 5'- TGTACAGTGT-3' core sequence. May function as a transcriptional transactivator and transcriptional repressor. Probably exerts its repressor effect by preventing GATA3 from binding to DNA. May play a role in regulating the differentiation and activation of helper T-cells. Belongs to the krueppel C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein; DNA-binding
Chromosomal Location of Human Ortholog: 19q13.1
Cellular Component: nucleoplasm; nucleus
Molecular Function: DNA binding; protein binding; transcription corepressor activity; zinc ion binding
Biological Process: DNA damage response, detection of DNA damage; negative regulation of transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter
Research Articles on ZBTB32
Similar Products
Product Notes
The ZBTB32 zbtb32 (Catalog #AAA1267640) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccctgc cccccataag actgcccagc ccctatggct ctgatcggct ggtacagcta gcagccaggc tccggccagc actctgtgat actctgatca ccgtagggag ccaggagttc cccgcccaca gcctggtgct agcaggtgtc agccagcagc tgggccgcag gggccagtgg gctctgggag aaggcatcag cccttctacc tttgcccagc tcctgaactt tgtgtatggg gagagtgtag agctgcagcc tggagagcta aggccccttc aggaggcggc cagggccttg ggagtgcagt ccctggaaga ggcatgctgg agggctcgag gggacagggc taaaaagcca gatccaggcc tgaagaaaca tcaggaggag ccagagaaac cctcaaggaa tcctgagaga gaactggggg accctggaga gaagcagaaa ccagaacagg tttctagaac tggtgggaga gaacaggaga tgttgcacaa gcactcgcca ccaagaggca gacccgagat ggcaggagca acgcaggagg ctcagcagga acagaccagg tcaaaggaga aacgcctcca agcccctgtt ggccaaaggg gagcagatgg gaagcatgga gtgctcacgt ggttgaggga aaatccaggg ggctctgagg aaagtctgcg caagctccct ggcccccttc ccccagcagg ctccctgcaa accagcgtca cccctaggcc ctcgtgggct gaggcccctt ggttggtggg gggccagcct gccctgtgga gcatcctgct gatgccgccc agatatggca ttcccttcta ccatagcacc cccaccactg gagcctggca ggaggtctgg cgggaacaga ggcgcacttg caacctgtgc gggtcatga. It is sometimes possible for the material contained within the vial of "ZBTB32, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
