Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NINJ1 cdna clone

NINJ1 cDNA Clone

Gene Names
NINJ1; NIN1; NINJURIN
Synonyms
NINJ1; NINJ1 cDNA Clone; NINJ1 cdna clone
Ordering
For Research Use Only!
Sequence
atggactcgggaaccgaggagtacgagctcaacggcggcctgcctccgggcacacccggctccccggacgcctcgccggcccgctggggctggaggcacgggcccatcaacgtgaaccattacgccagcaagaagagcgcagccgagagcatgctggacatcgcgctgctgatggccaacgcgtcccagctgaaggccgtcgtggaacagggccccagcttcgccttctatgtgcccctggtggtcctcatctccatctcccttgtgctgcagatcggcgtgggggtgctgctcatcttccttgtcaagtacgaccttaacaacccggacaagcacgccaagctggacttcctcaacaacctggccacgggcctggtgttcatcatcgtggtagtcaacatcttcatcacggccttcggggtccagaagcccttgatggacatggcaccccagcagtag
Sequence Length
459
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,345 Da
NCBI Official Full Name
Homo sapiens ninjurin 1, mRNA
NCBI Official Synonym Full Names
ninjurin 1
NCBI Official Symbol
NINJ1
NCBI Official Synonym Symbols
NIN1; NINJURIN
NCBI Protein Information
ninjurin-1
UniProt Protein Name
Ninjurin-1
Protein Family
UniProt Gene Name
NINJ1
UniProt Entry Name
NINJ1_HUMAN

NCBI Description

The ninjurin protein is upregulated after nerve injury both in dorsal root ganglion neurons and in Schwann cells (Araki and Milbrandt, 1996 [PubMed 8780658]). It demonstrates properties of a homophilic adhesion molecule and promotes neurite outgrowth from primary cultured dorsal root ganglion neurons.[supplied by OMIM, Aug 2009]

Uniprot Description

NINJ1: Homophilic cell adhesion molecule that promotes axonal growth. May play a role in nerve regeneration and in the formation and function of other tissues. Cell adhesion requires divalent cations. Belongs to the ninjurin family.

Protein type: Cell adhesion; Cell development/differentiation; Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 9q22

Molecular Function: protein binding

Biological Process: nervous system development

Research Articles on NINJ1

Similar Products

Product Notes

The NINJ1 ninj1 (Catalog #AAA1267593) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactcgg gaaccgagga gtacgagctc aacggcggcc tgcctccggg cacacccggc tccccggacg cctcgccggc ccgctggggc tggaggcacg ggcccatcaa cgtgaaccat tacgccagca agaagagcgc agccgagagc atgctggaca tcgcgctgct gatggccaac gcgtcccagc tgaaggccgt cgtggaacag ggccccagct tcgccttcta tgtgcccctg gtggtcctca tctccatctc ccttgtgctg cagatcggcg tgggggtgct gctcatcttc cttgtcaagt acgaccttaa caacccggac aagcacgcca agctggactt cctcaacaac ctggccacgg gcctggtgtt catcatcgtg gtagtcaaca tcttcatcac ggccttcggg gtccagaagc ccttgatgga catggcaccc cagcagtag. It is sometimes possible for the material contained within the vial of "NINJ1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.