PTRH1 cdna clone
PTRH1 cDNA Clone
Gene Names
PTRH1; PTH1; C9orf115
Synonyms
PTRH1; PTRH1 cDNA Clone; PTRH1 cdna clone
Sequence
atgaggccgggcggctttttgggcgccggacagcggctgagtagagccatgagccgatgtgttttggagcctcgccccccggggaagcggtggatggtggctggcctggggaatcccggactgcccggcacgcgacacagcgtgggcatggcggtgctggggcagctggcgcggcggctgggtgtggcggagagttggacgcgcgaccggcactgtgccgccgacctcgccctggccccgctgggggatgcccaactggtcctgctccggccacggcggcttatgaacgccaacgggcgcagcgtggcccgggctgcggagctgtttgggctgactgccgaggaagtctacctggtgcatgatgagctggacaagcccctggggagactggctctgaagctggggggcagtgccaggggccacaatggagtccgttcctgcattagctgcctcaactccaatgcaatgccaaggctgcgggtgggtatcgggcgcccggcgcaccctgaggcggttcaggcccatgtgctgggctgcttctcccctgctgagcaggagctgctgcctctgttgctggatcgagccaccgacctgatcttggaccacatccgtgagcgaagccaggggccctcactggggccgtga
Sequence Length
645
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
22,937 Da
NCBI Official Full Name
Homo sapiens peptidyl-tRNA hydrolase 1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
peptidyl-tRNA hydrolase 1 homolog
NCBI Official Symbol
PTRH1
NCBI Official Synonym Symbols
PTH1; C9orf115
NCBI Protein Information
probable peptidyl-tRNA hydrolase
UniProt Protein Name
Probable peptidyl-tRNA hydrolase
Protein Family
UniProt Gene Name
PTRH1
UniProt Synonym Gene Names
C9orf115; PTH
UniProt Entry Name
PTH_HUMAN
Uniprot Description
PTRH1: Belongs to the PTH family.
Protein type: Hydrolase; EC 3.1.1.29
Chromosomal Location of Human Ortholog: 9q34.11
Cellular Component: mitochondrion
Molecular Function: aminoacyl-tRNA hydrolase activity; protein binding
Biological Process: mitochondrial translation
Research Articles on PTRH1
Similar Products
Product Notes
The PTRH1 ptrh1 (Catalog #AAA1267578) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggccgg gcggcttttt gggcgccgga cagcggctga gtagagccat gagccgatgt gttttggagc ctcgcccccc ggggaagcgg tggatggtgg ctggcctggg gaatcccgga ctgcccggca cgcgacacag cgtgggcatg gcggtgctgg ggcagctggc gcggcggctg ggtgtggcgg agagttggac gcgcgaccgg cactgtgccg ccgacctcgc cctggccccg ctgggggatg cccaactggt cctgctccgg ccacggcggc ttatgaacgc caacgggcgc agcgtggccc gggctgcgga gctgtttggg ctgactgccg aggaagtcta cctggtgcat gatgagctgg acaagcccct ggggagactg gctctgaagc tggggggcag tgccaggggc cacaatggag tccgttcctg cattagctgc ctcaactcca atgcaatgcc aaggctgcgg gtgggtatcg ggcgcccggc gcaccctgag gcggttcagg cccatgtgct gggctgcttc tcccctgctg agcaggagct gctgcctctg ttgctggatc gagccaccga cctgatcttg gaccacatcc gtgagcgaag ccaggggccc tcactggggc cgtga. It is sometimes possible for the material contained within the vial of "PTRH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
