Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

P4HTM cdna clone

P4HTM cDNA Clone

Gene Names
P4HTM; PH4; PH-4; PHD4; EGLN4; HIFPH4; P4H-TM
Synonyms
P4HTM; P4HTM cDNA Clone; P4HTM cdna clone
Ordering
For Research Use Only!
Sequence
atggtgttcgtgcacctgtacctgggtaacgtgctggcgctgctgctcttcgtgcactacagcaacggcgacgaaagcagcgatcccgggccccaacaccgtgcccagggccccgggcccgagcccaccttaggtcccctcacccggctggagggcatcaaggtggggcacgagcgtaaggtccagctggtcaccgacagggatcacttcatccgaaccctcagcctcaagccgctgctcttcgaaatccccggcttcctgactgatgaagagtgtcggctcatcatccatctggcgcagatgaaggggttacagcgcagccagatcctgcctactgaagagtatgaagaggcaatgagcactatgcaggtcagccagctggacctcttccggctgctggaccagaaccgtgatgggcaccttcagctccgtgaggttctggcccagactcgcctgggaaatggatggtggatgactccagagagcattcaggagatgtacgccgcgatcaaggctgaccctgatggtgacggagtgctgagtctgcaggagttctccaacatggaccttcgggacttccacaagtacatgaggagccacaaggcagagtccagtgagctggtgcggaacagccaccatacctggctctaccagggtgagggtgcccaccacatcatgcgtgccatccgccagagggtgctgcgcctcactcgcctgtcgcctgagatcgtggagctcagcgagccgctgcaggttgttcgatatggtgaggggggccactaccatgcccacgtggacagtgggcctgtgtacccagagaccatctgctcccataccaagctggtagccaacgagtctgtacccttcgagacctcctgccggcaagtatctcccaactgggggctgccttcaatcctcagaccaggaacacccatgacacaggcacagccctgcactgtgggcgtgccccttggcatggggccaggagatcactgggttatcccggtaagcccctgggagcatccacaactggggacctgctcagtgccccccctgccttacagctacatgacagtgctgttttatttgaacaacgtcactggtgggggcgagactgttttccctgtagcagataacagaacctacgatgaaatgagtctgattcaggatgacgtggacctccgtgacacacggaggcactgtgacaagggaaacctgcgtgtcaagccccaacagggcacagcagtcttctggtacaactacctgcctgatgggcaaggttgggtgggtgacgtagacgactactcgctgcacgggggctgcctggtcacgcgcggcaccaagtggattgccaacaactggattaatgtggaccccagccgagcgcggcaagcgctgttccaacaggagatggcccgccttgcccgagaagggggcaccgactcacagcccgagtgggctctggaccgggcctaccgcgatgcgcgcgtggaactctga
Sequence Length
1500
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
63,112 Da
NCBI Official Full Name
Homo sapiens prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum), mRNA
NCBI Official Synonym Full Names
prolyl 4-hydroxylase, transmembrane
NCBI Official Symbol
P4HTM
NCBI Official Synonym Symbols
PH4; PH-4; PHD4; EGLN4; HIFPH4; P4H-TM
NCBI Protein Information
transmembrane prolyl 4-hydroxylase
UniProt Protein Name
Transmembrane prolyl 4-hydroxylase
UniProt Gene Name
P4HTM
UniProt Synonym Gene Names
PH4; P4H-TM; HIF-PH4; HIF-prolyl hydroxylase 4; HPH-4
UniProt Entry Name
P4HTM_HUMAN

NCBI Description

The product of this gene belongs to the family of prolyl 4-hydroxylases. This protein is a prolyl hydroxylase that may be involved in the degradation of hypoxia-inducible transcription factors under normoxia. It plays a role in adaptation to hypoxia and may be related to cellular oxygen sensing. Alternatively spliced variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

PH4: Catalyzes the post-translational formation of 4- hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates HIF1A at 'Pro-402' and 'Pro-564'. May function as a cellular oxygen sensor and, under normoxic conditions, may target HIF through the hydroxylation for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; EC 1.14.11.-; Oxidoreductase

Chromosomal Location of Human Ortholog: 3p21.31|3p21.3

Molecular Function: oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors

Research Articles on P4HTM

Similar Products

Product Notes

The P4HTM p4htm (Catalog #AAA1267557) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgttcg tgcacctgta cctgggtaac gtgctggcgc tgctgctctt cgtgcactac agcaacggcg acgaaagcag cgatcccggg ccccaacacc gtgcccaggg ccccgggccc gagcccacct taggtcccct cacccggctg gagggcatca aggtggggca cgagcgtaag gtccagctgg tcaccgacag ggatcacttc atccgaaccc tcagcctcaa gccgctgctc ttcgaaatcc ccggcttcct gactgatgaa gagtgtcggc tcatcatcca tctggcgcag atgaaggggt tacagcgcag ccagatcctg cctactgaag agtatgaaga ggcaatgagc actatgcagg tcagccagct ggacctcttc cggctgctgg accagaaccg tgatgggcac cttcagctcc gtgaggttct ggcccagact cgcctgggaa atggatggtg gatgactcca gagagcattc aggagatgta cgccgcgatc aaggctgacc ctgatggtga cggagtgctg agtctgcagg agttctccaa catggacctt cgggacttcc acaagtacat gaggagccac aaggcagagt ccagtgagct ggtgcggaac agccaccata cctggctcta ccagggtgag ggtgcccacc acatcatgcg tgccatccgc cagagggtgc tgcgcctcac tcgcctgtcg cctgagatcg tggagctcag cgagccgctg caggttgttc gatatggtga ggggggccac taccatgccc acgtggacag tgggcctgtg tacccagaga ccatctgctc ccataccaag ctggtagcca acgagtctgt acccttcgag acctcctgcc ggcaagtatc tcccaactgg gggctgcctt caatcctcag accaggaaca cccatgacac aggcacagcc ctgcactgtg ggcgtgcccc ttggcatggg gccaggagat cactgggtta tcccggtaag cccctgggag catccacaac tggggacctg ctcagtgccc cccctgcctt acagctacat gacagtgctg ttttatttga acaacgtcac tggtgggggc gagactgttt tccctgtagc agataacaga acctacgatg aaatgagtct gattcaggat gacgtggacc tccgtgacac acggaggcac tgtgacaagg gaaacctgcg tgtcaagccc caacagggca cagcagtctt ctggtacaac tacctgcctg atgggcaagg ttgggtgggt gacgtagacg actactcgct gcacgggggc tgcctggtca cgcgcggcac caagtggatt gccaacaact ggattaatgt ggaccccagc cgagcgcggc aagcgctgtt ccaacaggag atggcccgcc ttgcccgaga agggggcacc gactcacagc ccgagtgggc tctggaccgg gcctaccgcg atgcgcgcgt ggaactctga. It is sometimes possible for the material contained within the vial of "P4HTM, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.