Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PI15 cdna clone

PI15 cDNA Clone

Gene Names
PI15; P24TI; P25TI; CRISP8
Synonyms
PI15; PI15 cDNA Clone; PI15 cdna clone
Ordering
For Research Use Only!
Sequence
atgatagcaatctctgccgtcagcagtgcactcctgttctcccttctctgtgaagcaagtaccgtcgtcctactcaattccactgactcatccccgccaaccaataatttcactgatattgaagcagctctgaaagcacaattagattcagcggatatccccaaagccaggcggaagcgctacatttcgcagaatgacatgatcgccattcttgattatcataatcaagttcggggcaaagtgttcccaccggcagcaaatatggaatatatggtttgggatgaaaatcttgcaaaatcggcagaggcttgggcggctacttgcatttgggaccatggaccttcttacttactgagatttttgggccaaaatctatctgtacgcactggaagatatcgctctattctccagttggtcaagccatggtatgatgaagtgaaagattatgcttttccatatccccaggattgcaaccccagatgtcctatgagatgttttggtcccatgtgcacacattatacgcagatggtttgggccacttccaatcggataggatgcgcaattcatacttgccaaaacatgaatgtttggggatctgtgtggcgacgtgcagtttacttggtatgcaactatgccccaaagggcaattggattggagaagcaccatataaagtaggggtaccatgttcatcttgtcctccaagttatgggggatcttgtactgacaatctgtgttttccaggagttacgtcaaactacctgtactggtttaaataa
Sequence Length
777
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,065 Da
NCBI Official Full Name
Homo sapiens peptidase inhibitor 15, mRNA
NCBI Official Synonym Full Names
peptidase inhibitor 15
NCBI Official Symbol
PI15
NCBI Official Synonym Symbols
P24TI; P25TI; CRISP8
NCBI Protein Information
peptidase inhibitor 15
UniProt Protein Name
Peptidase inhibitor 15
Protein Family
UniProt Gene Name
PI15
UniProt Synonym Gene Names
CRISP8; P25TI; PI-15; p25TI; CRISP-8
UniProt Entry Name
PI15_HUMAN

NCBI Description

This gene encodes a trypsin inhibitor. The protein shares similarity to insect venom allergens, mammalian testis-specific proteins and plant pathogenesis-related proteins. It is frequently expressed in human neuroblastoma and glioblastoma cell lines, and thus may play a role in the central nervous system. [provided by RefSeq, Jul 2008]

Uniprot Description

PI15: Serine protease inhibitor which displays weak inhibitory activity against trypsin. Belongs to the CRISP family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 8q21.11

Similar Products

Product Notes

The PI15 pi15 (Catalog #AAA1267468) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatagcaa tctctgccgt cagcagtgca ctcctgttct cccttctctg tgaagcaagt accgtcgtcc tactcaattc cactgactca tccccgccaa ccaataattt cactgatatt gaagcagctc tgaaagcaca attagattca gcggatatcc ccaaagccag gcggaagcgc tacatttcgc agaatgacat gatcgccatt cttgattatc ataatcaagt tcggggcaaa gtgttcccac cggcagcaaa tatggaatat atggtttggg atgaaaatct tgcaaaatcg gcagaggctt gggcggctac ttgcatttgg gaccatggac cttcttactt actgagattt ttgggccaaa atctatctgt acgcactgga agatatcgct ctattctcca gttggtcaag ccatggtatg atgaagtgaa agattatgct tttccatatc cccaggattg caaccccaga tgtcctatga gatgttttgg tcccatgtgc acacattata cgcagatggt ttgggccact tccaatcgga taggatgcgc aattcatact tgccaaaaca tgaatgtttg gggatctgtg tggcgacgtg cagtttactt ggtatgcaac tatgccccaa agggcaattg gattggagaa gcaccatata aagtaggggt accatgttca tcttgtcctc caagttatgg gggatcttgt actgacaatc tgtgttttcc aggagttacg tcaaactacc tgtactggtt taaataa. It is sometimes possible for the material contained within the vial of "PI15, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.