Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CDKN3 cdna clone

CDKN3 cDNA Clone

Gene Names
CDKN3; KAP; CDI1; CIP2; KAP1
Synonyms
CDKN3; CDKN3 cDNA Clone; CDKN3 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagccgcccagttcaatacaaacaagttgtaaatttaaagatgttagaagaaatgtccaaaaagatacagaagaactaaagagctgtggtatacaagacatatttgttttctgcaccagaggggaactgtcaaaatatagagtcccaaaccttctggatctctaccagcaatgtggaattatcacccatcatcatccaatcgcagatggagggactcctgacatagccagctgctgtgaaataatggaagagcttacaacctgccttaaaaattaccgaaaaaccttaatacactgctatggaggacttgggagatcttgtcttgtagctgcttgtctcctactatacctgtctgacacaatatcaccagagcaagccatagacagcctgcgagacctaagaggatccggggcaatacagaccatcaagcaatacaattatcttcatgagtttcgggacaaattagctgcacatctatcatcaagagattcacaatcaagatctgtatcaagataa
Sequence Length
519
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,359 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase inhibitor 3, mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase inhibitor 3
NCBI Official Symbol
CDKN3
NCBI Official Synonym Symbols
KAP; CDI1; CIP2; KAP1
NCBI Protein Information
cyclin-dependent kinase inhibitor 3
UniProt Protein Name
Cyclin-dependent kinase inhibitor 3
UniProt Gene Name
CDKN3
UniProt Synonym Gene Names
CDI1; CIP2; KAP
UniProt Entry Name
CDKN3_HUMAN

NCBI Description

The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]

Uniprot Description

CDKN3: May play a role in cell cycle regulation. Dual specificity phosphatase active toward substrates containing either phosphotyrosine or phosphoserine residues. Dephosphorylates CDK2 at 'Thr-160' in a cyclin-dependent manner. Defects in CDKN3 are found in patients with hepatocellular carcinoma (HCC). Belongs to the protein-tyrosine phosphatase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; EC 3.1.3.16; Protein phosphatase, dual-specificity; EC 3.1.3.48; Cell cycle regulation

Chromosomal Location of Human Ortholog: 14q22

Cellular Component: cytoplasm; nucleus; perinuclear region of cytoplasm

Molecular Function: protein binding; protein serine/threonine phosphatase activity; protein tyrosine phosphatase activity; protein tyrosine/serine/threonine phosphatase activity

Biological Process: cell cycle arrest; G1/S transition of mitotic cell cycle; negative regulation of cell proliferation; regulation of cyclin-dependent protein kinase activity

Disease: Hepatocellular Carcinoma

Research Articles on CDKN3

Similar Products

Product Notes

The CDKN3 cdkn3 (Catalog #AAA1267467) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagccgc ccagttcaat acaaacaagt tgtaaattta aagatgttag aagaaatgtc caaaaagata cagaagaact aaagagctgt ggtatacaag acatatttgt tttctgcacc agaggggaac tgtcaaaata tagagtccca aaccttctgg atctctacca gcaatgtgga attatcaccc atcatcatcc aatcgcagat ggagggactc ctgacatagc cagctgctgt gaaataatgg aagagcttac aacctgcctt aaaaattacc gaaaaacctt aatacactgc tatggaggac ttgggagatc ttgtcttgta gctgcttgtc tcctactata cctgtctgac acaatatcac cagagcaagc catagacagc ctgcgagacc taagaggatc cggggcaata cagaccatca agcaatacaa ttatcttcat gagtttcggg acaaattagc tgcacatcta tcatcaagag attcacaatc aagatctgta tcaagataa. It is sometimes possible for the material contained within the vial of "CDKN3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.