Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CAPZB cdna clone

CAPZB cDNA Clone

Gene Names
CAPZB; CAPB; CAPZ; CAPPB
Synonyms
CAPZB; CAPZB cDNA Clone; CAPZB cdna clone
Ordering
For Research Use Only!
Sequence
atgctaaacctctgtttcatgctaaccagacacgccgtgcactcgttagattcctttcttagaaaactcgttttctgctcccttccctcgtcccttccctccccgacaggtcacataacagctgcatcattgaccgcacagcgccatctctccctgagaataaagccgatagccaccctcctccggctccgagcctgcttctgccacacctcgctctcagttctctccacatttccatag
Sequence Length
240
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
832
Molecular Weight
– Da
NCBI Official Full Name
Homo sapiens capping protein (actin filament) muscle Z-line, beta, mRNA
NCBI Official Synonym Full Names
capping actin protein of muscle Z-line beta subunit
NCBI Official Symbol
CAPZB
NCBI Official Synonym Symbols
CAPB; CAPZ; CAPPB
NCBI Protein Information
F-actin-capping protein subunit beta
UniProt Protein Name
F-actin-capping protein subunit beta
Protein Family
UniProt Gene Name
CAPZB
UniProt Entry Name
CAPZB_HUMAN

NCBI Description

This gene encodes the beta subunit of the barbed-end actin binding protein, which belongs to the F-actin capping protein family. The capping protein is a heterodimeric actin capping protein that blocks actin filament assembly and disassembly at the fast growing (barbed) filament ends and functions in regulating actin filament dynamics as well as in stabilizing actin filament lengths in muscle and nonmuscle cells. A pseudogene of this gene is located on the long arm of chromosome 2. Multiple alternatively spliced transcript variants encoding different isoforms have been found.[provided by RefSeq, Aug 2013]

Uniprot Description

CAPZB: F-actin-capping proteins bind in a Ca(2+)-independent manner to the fast growing ends of actin filaments (barbed end) thereby blocking the exchange of subunits at these ends. Unlike other capping proteins (such as gelsolin and severin), these proteins do not sever actin filaments. Plays a role in the regulation of cell morphology and cytoskeletal organization. Belongs to the F-actin-capping protein beta subunit family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; Actin-binding

Chromosomal Location of Human Ortholog: 1p36.1

Cellular Component: actin cytoskeleton; actin filament; cell-cell adherens junction; cytoskeleton; cytosol

Molecular Function: actin binding; actin filament binding

Biological Process: barbed-end actin filament capping; blood coagulation; cell motility; cytoskeleton organization and biogenesis; negative regulation of filopodium formation; regulation of cell morphogenesis

Research Articles on CAPZB

Similar Products

Product Notes

The CAPZB capzb (Catalog #AAA1267435) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctaaacc tctgtttcat gctaaccaga cacgccgtgc actcgttaga ttcctttctt agaaaactcg ttttctgctc ccttccctcg tcccttccct ccccgacagg tcacataaca gctgcatcat tgaccgcaca gcgccatctc tccctgagaa taaagccgat agccaccctc ctccggctcc gagcctgctt ctgccacacc tcgctctcag ttctctccac atttccatag. It is sometimes possible for the material contained within the vial of "CAPZB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.