Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB2B cdna clone

RAB2B cDNA Clone

Synonyms
RAB2B; RAB2B cDNA Clone; RAB2B cdna clone
Ordering
For Research Use Only!
Sequence
atgacttatgcttatctcttcaagtatatcatcatcggagacacaggtgtggggaagtcatgtctcctcctgcagtttacagataagcggttccagcctgtccacgacctcacaataggtgtggagtttggagctcgtatggtcaacattgatggaaaacaaatcaaactgcaaatctgggatacggctgggcaagaatccttccgttctatcacccgttcctactacaggggagcagctggagcactgctggtgtacgacattacaaggcgtgaaaccttcaaccacctgacctcatggttagaggatgcccggcagcactctagttccaacatggttatcatgctcattgggaataagagtgacctagagtcccgcagggatgtgaagagagaagaaggagaggcctttgctagggagcatggacttatattcatggaaacttcagccaaaacagcctgcaatgttgaagaggccttcattaacacagccaaagaaatatataggaagatccagcagggtttatttgatgtccacaatgaggcaaatggcatcaagattgggccccaacagtcaatttcaacatcagtgggacccagtgcctcccagcggaactctcgtgacatagggtccaactctggctgctgctga
Sequence Length
651
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,667 Da
NCBI Official Full Name
Homo sapiens RAB2B, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB2B, member RAS oncogene family
NCBI Official Symbol
RAB2B
NCBI Protein Information
ras-related protein Rab-2B
UniProt Protein Name
Ras-related protein Rab-2B
Protein Family
UniProt Gene Name
RAB2B
UniProt Entry Name
RAB2B_HUMAN

NCBI Description

Members of the Rab protein family are nontransforming monomeric GTP-binding proteins of the Ras superfamily that contain 4 highly conserved regions involved in GTP binding and hydrolysis. Rab proteins are prenylated, membrane-bound proteins involved in vesicular fusion and trafficking; see MIM 179508.[supplied by OMIM, Apr 2006]

Uniprot Description

RAB2B: Required for protein transport from the endoplasmic reticulum to the Golgi complex (Potential). Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein, monomeric; G protein; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 14q11.2

Molecular Function: protein binding

Biological Process: positive regulation of exocytosis

Research Articles on RAB2B

Similar Products

Product Notes

The RAB2B rab2b (Catalog #AAA1267031) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacttatg cttatctctt caagtatatc atcatcggag acacaggtgt ggggaagtca tgtctcctcc tgcagtttac agataagcgg ttccagcctg tccacgacct cacaataggt gtggagtttg gagctcgtat ggtcaacatt gatggaaaac aaatcaaact gcaaatctgg gatacggctg ggcaagaatc cttccgttct atcacccgtt cctactacag gggagcagct ggagcactgc tggtgtacga cattacaagg cgtgaaacct tcaaccacct gacctcatgg ttagaggatg cccggcagca ctctagttcc aacatggtta tcatgctcat tgggaataag agtgacctag agtcccgcag ggatgtgaag agagaagaag gagaggcctt tgctagggag catggactta tattcatgga aacttcagcc aaaacagcct gcaatgttga agaggccttc attaacacag ccaaagaaat atataggaag atccagcagg gtttatttga tgtccacaat gaggcaaatg gcatcaagat tgggccccaa cagtcaattt caacatcagt gggacccagt gcctcccagc ggaactctcg tgacataggg tccaactctg gctgctgctg a. It is sometimes possible for the material contained within the vial of "RAB2B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.