Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GSTT1 cdna clone

GSTT1 cDNA Clone

Synonyms
GSTT1; GSTT1 cDNA Clone; GSTT1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcctggagctgtacctggacctgctgtcccagccctgccgcgctgtttacatctttgccaagaagaacgacattcccttcgagctgcgcatcgtggatctgattaaaggtcagcacttaagcgatgcctgtgcccaggtgaaccccctcaagaaggtgccagccttgaaggacggggacttcaccttgacggagagtgtggccatcctgctctacctgacgcgcaaatataaggtccctgactactggtaccctcaggacctgcaggcccgtgcccgtgtggatgagtacctggcatggcagcacacgactctgcggagaagctgcctccgggccttgtggcataaggtgatgttccctgttttcctgggtgagccagtatctccccagacactggcagccaccctggcagagttggatgtgaccctgcagttgctcgaggacaagttcctccagaacaaggccttccttactggtcctcacatctccttagctgacctcgtagccatcacggagctgatgcatcccgtgggtgctggctgccaagtcttcgaaggccgacccaagctggccacatggcggcagcgcgtggaggcagcagtgggggaggacctcttccaggaggcccatgaggtcattctgaaggccaaggacttcccacctgcagaccccaccataaaacagaagctgatgccctgggtgctggccatgatccggtga
Sequence Length
723
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
13,517 Da
NCBI Official Full Name
Homo sapiens glutathione S-transferase theta 1, mRNA
NCBI Official Synonym Full Names
glutathione S-transferase theta 1
NCBI Official Symbol
GSTT1
NCBI Protein Information
glutathione S-transferase theta-1
UniProt Protein Name
Glutathione S-transferase theta-1
Protein Family
UniProt Gene Name
GSTT1
UniProt Entry Name
GSTT1_HUMAN

NCBI Description

The protein encoded by this gene, glutathione S-transferase (GST) theta 1 (GSTT1), is a member of a superfamily of proteins that catalyze the conjugation of reduced glutathione to a variety of electrophilic and hydrophobic compounds. Human GSTs can be divided into five main classes: alpha, mu, pi, theta, and zeta. The theta class includes GSTT1, GSTT2, and GSTT2B. GSTT1 and GSTT2/GSTT2B share 55% amino acid sequence identity and may play a role in human carcinogenesis. The GSTT1 gene is haplotype-specific and is absent from 38% of the population. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2015]

Uniprot Description

GSTT1: Conjugation of reduced glutathione to a wide number of exogenous and endogenous hydrophobic electrophiles. Acts on 1,2- epoxy-3-(4-nitrophenoxy)propane, phenethylisothiocyanate 4- nitrobenzyl chloride and 4-nitrophenethyl bromide. Displays glutathione peroxidase activity with cumene hydroperoxide. Belongs to the GST superfamily. Theta family.

Protein type: Xenobiotic Metabolism - metabolism by cytochrome P450; Other Amino Acids Metabolism - glutathione; EC 2.5.1.18; Xenobiotic Metabolism - drug metabolism - cytochrome P450; Transferase

Chromosomal Location of Human Ortholog: 22q11.23

Cellular Component: cytosol

Molecular Function: glutathione peroxidase activity; glutathione transferase activity

Biological Process: glutathione metabolic process

Research Articles on GSTT1

Similar Products

Product Notes

The GSTT1 gstt1 (Catalog #AAA1266999) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcctgg agctgtacct ggacctgctg tcccagccct gccgcgctgt ttacatcttt gccaagaaga acgacattcc cttcgagctg cgcatcgtgg atctgattaa aggtcagcac ttaagcgatg cctgtgccca ggtgaacccc ctcaagaagg tgccagcctt gaaggacggg gacttcacct tgacggagag tgtggccatc ctgctctacc tgacgcgcaa atataaggtc cctgactact ggtaccctca ggacctgcag gcccgtgccc gtgtggatga gtacctggca tggcagcaca cgactctgcg gagaagctgc ctccgggcct tgtggcataa ggtgatgttc cctgttttcc tgggtgagcc agtatctccc cagacactgg cagccaccct ggcagagttg gatgtgaccc tgcagttgct cgaggacaag ttcctccaga acaaggcctt ccttactggt cctcacatct ccttagctga cctcgtagcc atcacggagc tgatgcatcc cgtgggtgct ggctgccaag tcttcgaagg ccgacccaag ctggccacat ggcggcagcg cgtggaggca gcagtggggg aggacctctt ccaggaggcc catgaggtca ttctgaaggc caaggacttc ccacctgcag accccaccat aaaacagaag ctgatgccct gggtgctggc catgatccgg tga. It is sometimes possible for the material contained within the vial of "GSTT1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.