DNAJB12 cdna clone
DNAJB12 cDNA Clone
Gene Names
DNAJB12; DJ10
Synonyms
DNAJB12; DNAJB12 cDNA Clone; DNAJB12 cdna clone
Sequence
atggaatccaacaaggatgaagctgagcgctgtatcagcatcgccctcaaggccatccagagcaaccagcccgaccgggcgctccgcttcctggagaaggcacagcggctgtatccgacgccgcgagttcgcgccctgattgagtccctcaaccagaaaccacagactgccggtgaccaacccccacccacagacacaacccatgccacccacaggaaagcaggtgggaccgatgccccctcggccaacggtgaagctggaggagagagcaccaaaggctacactgcagaacaggttgcagctgtgaaaagggtcaagcaatgtaaagattactatgagatcctgggggtgagcagaggggcctcggatgaggacctgaagaaggcctaccgcagactggccctcaaattccacccagacaagaaccacgcacctggtgccactgaagccttcaaagccattggcacagcatatgcggtactcagcaacccggagaagaggaagcagtatgaccagttcggcgatgacaagagccaggcggcccggcacggccatgggcatggggatttccaccgtggctttgaggccgacatctcccctgaagacctcttcaacatgttctttggcggcggcttcccttctagtaacgtccacgtctacagcaacggccgcatgcgctatacctaccagcaaaggcaggaccgcagggacaaccagggtgatggcgggctaggggtgtttgtgcagctgatgcctatcctcatcctgattctcgtgtcagctctcagccagctcatggtctccagtccaccctacagtctgagtccaagaccgtccgtgggccacatccacaggcgagtcactgaccacctgggtgtcgtctactatgtgggagacactttctccgaagagtacacaggctccagcctcaaaacagtcgagcggaatgtggaagatgattatatcgccaacctccggaacaactgctggaaggagaagcagcagaaggaaggcttgctgtaccgggcacgctactttggcgacacagatatgtaccacagagcacagaagatgggcacccccagctgcagccgactgtcagaggtgcaggcctccctgcatggatag
Sequence Length
1128
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,263 Da
NCBI Official Full Name
Homo sapiens DnaJ (Hsp40) homolog, subfamily B, member 12, mRNA
NCBI Official Synonym Full Names
DnaJ heat shock protein family (Hsp40) member B12
NCBI Official Symbol
DNAJB12
NCBI Official Synonym Symbols
DJ10
NCBI Protein Information
dnaJ homolog subfamily B member 12
UniProt Protein Name
DnaJ homolog subfamily B member 12
Protein Family
UniProt Gene Name
DNAJB12
UniProt Entry Name
DJB12_HUMAN
NCBI Description
DNAJB12 belongs to the evolutionarily conserved DNAJ/HSP40 family of proteins, which regulate molecular chaperone activity by stimulating ATPase activity. DNAJ proteins may have up to 3 distinct domains: a conserved 70-amino acid J domain, usually at the N terminus; a glycine/phenylalanine (G/F)-rich region; and a cysteine-rich domain containing 4 motifs resembling a zinc finger domain (Ohtsuka and Hata, 2000 [PubMed 11147971]).[supplied by OMIM, Mar 2008]
Uniprot Description
DNAJB12: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Chaperone; Membrane protein, integral
Chromosomal Location of Human Ortholog: 10q22.1
Cellular Component: membrane
Research Articles on DNAJB12
Similar Products
Product Notes
The DNAJB12 dnajb12 (Catalog #AAA1266934) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaatcca acaaggatga agctgagcgc tgtatcagca tcgccctcaa ggccatccag agcaaccagc ccgaccgggc gctccgcttc ctggagaagg cacagcggct gtatccgacg ccgcgagttc gcgccctgat tgagtccctc aaccagaaac cacagactgc cggtgaccaa cccccaccca cagacacaac ccatgccacc cacaggaaag caggtgggac cgatgccccc tcggccaacg gtgaagctgg aggagagagc accaaaggct acactgcaga acaggttgca gctgtgaaaa gggtcaagca atgtaaagat tactatgaga tcctgggggt gagcagaggg gcctcggatg aggacctgaa gaaggcctac cgcagactgg ccctcaaatt ccacccagac aagaaccacg cacctggtgc cactgaagcc ttcaaagcca ttggcacagc atatgcggta ctcagcaacc cggagaagag gaagcagtat gaccagttcg gcgatgacaa gagccaggcg gcccggcacg gccatgggca tggggatttc caccgtggct ttgaggccga catctcccct gaagacctct tcaacatgtt ctttggcggc ggcttccctt ctagtaacgt ccacgtctac agcaacggcc gcatgcgcta tacctaccag caaaggcagg accgcaggga caaccagggt gatggcgggc taggggtgtt tgtgcagctg atgcctatcc tcatcctgat tctcgtgtca gctctcagcc agctcatggt ctccagtcca ccctacagtc tgagtccaag accgtccgtg ggccacatcc acaggcgagt cactgaccac ctgggtgtcg tctactatgt gggagacact ttctccgaag agtacacagg ctccagcctc aaaacagtcg agcggaatgt ggaagatgat tatatcgcca acctccggaa caactgctgg aaggagaagc agcagaagga aggcttgctg taccgggcac gctactttgg cgacacagat atgtaccaca gagcacagaa gatgggcacc cccagctgca gccgactgtc agaggtgcag gcctccctgc atggatag. It is sometimes possible for the material contained within the vial of "DNAJB12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
