Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LEPREL1 cdna clone

LEPREL1 cDNA Clone

Gene Names
P3H2; MCVD; MLAT4; LEPREL1
Synonyms
LEPREL1; LEPREL1 cDNA Clone; LEPREL1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaaatgcagcagaacattgagaattacagggcgacagctggtgttgaagcattgcagttggtagacagagaagccaagccacacatggagagttacaatgcaggagttaaacattatgaggctgatgactttgagatggctatcaggcatttcgaacaagccttaagagaatatttcgttgaagatacagaatgccggaccctatgtgaggggcctcagagatttgaagaatatgagtatttagggtataaggctggtctgtatgaagctattgcagatcactacatgcaggtgcttgtttgtcagcatgaatgtgtgagggaacttgccacccgccctggccgcctctctcccatcgagaattttcttcctctgcactatgattacctacagtttgcctactatcgagttggtgagtatgtgaaagccctggagtgtgccaaagcctatcttctatgccatccagatgatgaggatgtcctagacaatgtggattactatgagagtctgctggatgatagcattgacccggcatccattgaggccagagaggatttaacaatgtttgtgaaacgtcataagctggagtctgagctgataaaatcagctgcagaaggtctggggttttcatacactgaaccgaattattggatcagatatggaggacgacaggatgagaatcgggtcccttcaggagtgaacgtagagggagcagaagttcatggattctcaatgggaaaaaagctatcacccaagatagatcgagacctaagagaaggtggtcctctactctatgagaacatcacattcgtctacaactcggagcagctgaacgggactcagcgggttctcctggataacgtcctgtcggaagaacagtgccgggagctccacagcgtggccagtggaatcatgcttgttggtgatggatacagaggaaaaacttcaccccatacacccaatgaaaagtttgaaggtgcaactgtcctgaaagcactcaaatctggttatgaaggtcgagtcccactgaagagcgctcgtctgttttatgacatcagcgaaaaggctcgaaggattgtagaatcttattttatgctgaactcaactctgtatttttcctatacacacatggtctgccgaacagccctgtctggtcagcaggatagaagaaatgacctcagtcatcccatccatgctgacaactgtttgttggatccagaggccaacgaatgctggaaggagcctcctgcttacacatttcgagactatagtgctctcctatatatgaatgatgactttgaaggaggagaattcatattcacagagatggatgctaagactgtgactgcctctataaaaccaaaatgtgggcgcatgatcagcttctcatctggaggagagaaccctcatggggtgaaggcagtcaccaagggaaagaggtgtgctgtggctctgtggttcaccttggacccactttatagagaattggagcgaatacaggctgatgaagtgattgcaattctggatcaagaacagcaagggaagcatgaactgaatatcaaccctaaagatgagctataa
Sequence Length
1584
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
60,387 Da
NCBI Official Full Name
Homo sapiens leprecan-like 1, mRNA
NCBI Official Synonym Full Names
prolyl 3-hydroxylase 2
NCBI Official Symbol
P3H2
NCBI Official Synonym Symbols
MCVD; MLAT4; LEPREL1
NCBI Protein Information
prolyl 3-hydroxylase 2
UniProt Protein Name
Prolyl 3-hydroxylase 2
UniProt Gene Name
P3H2
UniProt Entry Name
P3H2_HUMAN

NCBI Description

This gene encodes a member of the prolyl 3-hydroxylase subfamily of 2-oxo-glutarate-dependent dioxygenases. These enzymes play a critical role in collagen chain assembly, stability and cross-linking by catalyzing post-translational 3-hydroxylation of proline residues. Mutations in this gene are associated with nonsyndromic severe myopia with cataract and vitreoretinal degeneration, and downregulation of this gene may play a role in breast cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

LEPREL1: Shows prolyl 3-hydroxylase activity catalyzing the post- translational formation of 3-hydroxyproline in -Xaa-Pro-Gly- sequences in collagens, especially types II, IV and V. Defects in LEPREL1 are the cause of myopia high with cataract and vitreoretinal degeneration (MCVD). A disorder characterized by severe myopia with variable expressivity of cataract and vitreoretinal degeneration. Some patients manifest lens subluxation, lens instability and retinal detachment. Belongs to the leprecan family.

Protein type: EC 1.14.11.7; Oxidoreductase

Chromosomal Location of Human Ortholog: 3q28

Cellular Component: basement membrane; endoplasmic reticulum; endoplasmic reticulum lumen; Golgi apparatus

Molecular Function: procollagen-proline 3-dioxygenase activity

Biological Process: collagen metabolic process; negative regulation of cell proliferation; peptidyl-proline hydroxylation

Disease: Myopia, High, With Cataract And Vitreoretinal Degeneration

Research Articles on LEPREL1

Similar Products

Product Notes

The LEPREL1 p3h2 (Catalog #AAA1266612) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaaatgc agcagaacat tgagaattac agggcgacag ctggtgttga agcattgcag ttggtagaca gagaagccaa gccacacatg gagagttaca atgcaggagt taaacattat gaggctgatg actttgagat ggctatcagg catttcgaac aagccttaag agaatatttc gttgaagata cagaatgccg gaccctatgt gaggggcctc agagatttga agaatatgag tatttagggt ataaggctgg tctgtatgaa gctattgcag atcactacat gcaggtgctt gtttgtcagc atgaatgtgt gagggaactt gccacccgcc ctggccgcct ctctcccatc gagaattttc ttcctctgca ctatgattac ctacagtttg cctactatcg agttggtgag tatgtgaaag ccctggagtg tgccaaagcc tatcttctat gccatccaga tgatgaggat gtcctagaca atgtggatta ctatgagagt ctgctggatg atagcattga cccggcatcc attgaggcca gagaggattt aacaatgttt gtgaaacgtc ataagctgga gtctgagctg ataaaatcag ctgcagaagg tctggggttt tcatacactg aaccgaatta ttggatcaga tatggaggac gacaggatga gaatcgggtc ccttcaggag tgaacgtaga gggagcagaa gttcatggat tctcaatggg aaaaaagcta tcacccaaga tagatcgaga cctaagagaa ggtggtcctc tactctatga gaacatcaca ttcgtctaca actcggagca gctgaacggg actcagcggg ttctcctgga taacgtcctg tcggaagaac agtgccggga gctccacagc gtggccagtg gaatcatgct tgttggtgat ggatacagag gaaaaacttc accccataca cccaatgaaa agtttgaagg tgcaactgtc ctgaaagcac tcaaatctgg ttatgaaggt cgagtcccac tgaagagcgc tcgtctgttt tatgacatca gcgaaaaggc tcgaaggatt gtagaatctt attttatgct gaactcaact ctgtattttt cctatacaca catggtctgc cgaacagccc tgtctggtca gcaggataga agaaatgacc tcagtcatcc catccatgct gacaactgtt tgttggatcc agaggccaac gaatgctgga aggagcctcc tgcttacaca tttcgagact atagtgctct cctatatatg aatgatgact ttgaaggagg agaattcata ttcacagaga tggatgctaa gactgtgact gcctctataa aaccaaaatg tgggcgcatg atcagcttct catctggagg agagaaccct catggggtga aggcagtcac caagggaaag aggtgtgctg tggctctgtg gttcaccttg gacccacttt atagagaatt ggagcgaata caggctgatg aagtgattgc aattctggat caagaacagc aagggaagca tgaactgaat atcaacccta aagatgagct ataa. It is sometimes possible for the material contained within the vial of "LEPREL1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.