Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALS2CR12 cdna clone

ALS2CR12 cDNA Clone

Synonyms
ALS2CR12; ALS2CR12 cDNA Clone; ALS2CR12 cdna clone
Ordering
For Research Use Only!
Sequence
atgtaccccaaccctctcatctactgcacctgctgggacccctggaacttgggaccacggaagctaatcaagacccctcaactaccacgcaagaactccacagggagttccaagctaactcctcttctaccagctccaaaaaatcacaattacctccaaccaacaaaacctgttgtttccccaaaaatgaaaatccattcagcaaggcaagaagagactaataaatcattttatgaagtgatcaacgtgtcacctggctatcaacttgttcggaatcgggaacagatttctgtcaccttaggggatgagatgtttgataggaaaaagcggtgggaatcggagatcccggacaaaggcagattttccaggaccaacatcatttctgacctagaagagcaaatctcagagctgacagcaataattgaacaaatgaacagagaccaccagtctgcccagaaattgctctccagtgaaatggatctccgctgtgctgagatgaaacagaactttgaaaacaagaacagggagctcaaagaggcccatgaagcagaactcagtgagttggagaacaactacaaagcagccttgaaggcagagaagttggctgcccaagagaagctagaggagatgggaaaagaatacaagtatttgaagaatatgtttcgtacgtatcaggacagtatttatgatgaaatggaagagaagtggtcaaaacagaaggcgaaatggaagaaggatgagaagttcgagcgagaaaatatcctgctacagcaaaaaaaaaagatgaccaaaaaattcgaaatggagtcaggagaagaagataagaaaataaatgaatcctgcagtgctgtctttgagaacttcattcaagagaaggaggagctcttgaaacaacatcaaagtgacaccttgcaattagaagagctgagaaaaaccaaagaggtcatgcaggaagaattgcatgcacaagcccttatcctagagtcactgaacacaaacctctactatacccagttggaactccagaaagagaaagctatagtgggaaatctggagaaaatgcttcaaaccaagtttgctgaaactgaagaaaagtataagcacaccatacagatcctgacggaagagaacattcatctgaagcaaaagataatttctaagaatgaagaaatttgtgaaggatgttctgggagattggcctctattactgtttctaaggatgattctgacactgtgcaagatggtagcaagaaaggacaagaatcataa
Sequence Length
1269
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,474 Da
NCBI Official Full Name
Homo sapiens amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 12, mRNA
NCBI Official Synonym Full Names
amyotrophic lateral sclerosis 2 chromosome region candidate 12
NCBI Official Symbol
ALS2CR12
NCBI Protein Information
amyotrophic lateral sclerosis 2 chromosomal region candidate gene 12 protein
UniProt Protein Name
Amyotrophic lateral sclerosis 2 chromosomal region candidate gene 12 protein
UniProt Gene Name
ALS2CR12
UniProt Entry Name
AL2SB_HUMAN

Uniprot Description

ALS2CR12: 2 isoforms of the human protein are produced by alternative splicing

Chromosomal Location of Human Ortholog: 2q33.1

Molecular Function: protein binding

Research Articles on ALS2CR12

Similar Products

Product Notes

The ALS2CR12 als2cr12 (Catalog #AAA1266598) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtacccca accctctcat ctactgcacc tgctgggacc cctggaactt gggaccacgg aagctaatca agacccctca actaccacgc aagaactcca cagggagttc caagctaact cctcttctac cagctccaaa aaatcacaat tacctccaac caacaaaacc tgttgtttcc ccaaaaatga aaatccattc agcaaggcaa gaagagacta ataaatcatt ttatgaagtg atcaacgtgt cacctggcta tcaacttgtt cggaatcggg aacagatttc tgtcacctta ggggatgaga tgtttgatag gaaaaagcgg tgggaatcgg agatcccgga caaaggcaga ttttccagga ccaacatcat ttctgaccta gaagagcaaa tctcagagct gacagcaata attgaacaaa tgaacagaga ccaccagtct gcccagaaat tgctctccag tgaaatggat ctccgctgtg ctgagatgaa acagaacttt gaaaacaaga acagggagct caaagaggcc catgaagcag aactcagtga gttggagaac aactacaaag cagccttgaa ggcagagaag ttggctgccc aagagaagct agaggagatg ggaaaagaat acaagtattt gaagaatatg tttcgtacgt atcaggacag tatttatgat gaaatggaag agaagtggtc aaaacagaag gcgaaatgga agaaggatga gaagttcgag cgagaaaata tcctgctaca gcaaaaaaaa aagatgacca aaaaattcga aatggagtca ggagaagaag ataagaaaat aaatgaatcc tgcagtgctg tctttgagaa cttcattcaa gagaaggagg agctcttgaa acaacatcaa agtgacacct tgcaattaga agagctgaga aaaaccaaag aggtcatgca ggaagaattg catgcacaag cccttatcct agagtcactg aacacaaacc tctactatac ccagttggaa ctccagaaag agaaagctat agtgggaaat ctggagaaaa tgcttcaaac caagtttgct gaaactgaag aaaagtataa gcacaccata cagatcctga cggaagagaa cattcatctg aagcaaaaga taatttctaa gaatgaagaa atttgtgaag gatgttctgg gagattggcc tctattactg tttctaagga tgattctgac actgtgcaag atggtagcaa gaaaggacaa gaatcataa. It is sometimes possible for the material contained within the vial of "ALS2CR12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.