CDKL3 cdna clone
CDKL3 cDNA Clone
Gene Names
CDKL3; NKIAMRE
Synonyms
CDKL3; CDKL3 cDNA Clone; CDKL3 cdna clone
Sequence
atggagatgtatgaaacccttggaaaagtgggagagggaagttacggaacagtcatgaaatgtaaacataagaatactgggcagatagtggccattaagatattttatgagagaccagaacaatctgtcaacaaaattgcgatgagagaaataaagtttctaaagcaatttcatcacgaaaacctggtcaatctgattgaagtttttagacagaaaaagaaaattcatttggtatttgaatttattgaccacacagtattagatgagttacaacattattgtcatggactagagagtaagcgacttagaaaatacctcttccagatccttcgagcaattgactatcttcacagtaataatatcattcatcgagatataaaacctgagaatattttagtatcccagtcaggaattactaagctctgtgattttggttttgcacgaacactagcagctcctggggacatttatacggactatgtggccacacgctggtatagagctcccgaattagtattaaaagatacttcttatggaaaacctgtggatatctgggctttgggctgtatgatcattgagatggccactggaaatccctatcttcctagtagttctgatttggatttactccataaaattgttttgaaagtgggcaatttgtcacctcacttgcagaatatcttttccaagagccccatttttgctggggtagttcttcctcaagttcaacaccccaaaaatgcaagaaaaaaatatccaaagcttaatggattgttggcagatatagttcatgcttgtttacaaattgatcctgctgacaggatatcatctagtgatcttttgcatcatgagtattttactagagatggatttattgaaaaattcatgccagaactgaaagctaaattactgcaggaagcaaaagtcaattcattaataaagccaaaagagagttctaaagaaaatgaactcaggaaagatgaaagaaaaacagtttataccaatacactgctaagtagttcagttttgggaaaggaaatagaaaaagagaaaaagcccaaggagatcaaagtcagagttattaaagtcaaaggaggaagaggagatatctcagaaccaaaaaagaaagagtatgaaggtggacttggtcaacaggatgcaaatgaaaatgttcatcctatgtctccagatacaaaacttgtaaccattgaaccaccaaaccctatcaatcccagcactaactgtaatggcttgaaagaaaatccacattgcggaggttctgtgacaatgccacccatcaatctaactaacagtaatttgatggctgcaaatctcagttcaaatctctttcaccccagtgtgaggttaactgaaagagcaaaaaagagacgcacttcttcacaatctattggacaagttatgcctaatagcaggcaagaggatccaggtcctattcaaagccaaatggagaagggtatatttaatgagcgaacaggtcacagtgaccaaatggcaaatgagaacaaaaggaagctgaatttttccagatctgacaggaaagaattccattttccagaattgcctgtcacaatacagtcaaaagatacaaaaggaatggaagttaaacagataaaaatgctgaagagggagtcaaagaaaacagagtcatctaagataccaactttacttaacgtggatcaaaatcaagaaaaacaagagggtggagatggccattgcgaggggaagaatttgaagagaaacaggttttttttctggtag
Sequence Length
1779
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
51,566 Da
NCBI Official Full Name
Homo sapiens cyclin-dependent kinase-like 3, mRNA
NCBI Official Synonym Full Names
cyclin dependent kinase like 3
NCBI Official Symbol
CDKL3
NCBI Official Synonym Symbols
NKIAMRE
NCBI Protein Information
cyclin-dependent kinase-like 3
UniProt Protein Name
Cyclin-dependent kinase-like 3
Protein Family
UniProt Gene Name
CDKL3
UniProt Synonym Gene Names
NKIAMRE
UniProt Entry Name
CDKL3_HUMAN
NCBI Description
The protein encoded by this gene is a member of cyclin-dependent protein kinase (CDK) family. CDK family members are highly similar to the gene products of Saccharomyces cerevisiae cdc28, and Schizosaccharomyces pombe cdc2, and are known to be important regulators of cell cycle progression. This gene was identified as a gene absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Uniprot Description
CDKL3: a protein kinase of the CDKL family. Absent in leukemic patients with chromosome 5q deletion. This loss may be an important determinant of dysmyelopoiesis. The function of this gene has not yet been determined.
Protein type: Kinase, protein; Protein kinase, CMGC; EC 2.7.11.22; Cell cycle regulation; Protein kinase, Ser/Thr (non-receptor); CMGC group; CDKL family
Chromosomal Location of Human Ortholog: 5q31
Molecular Function: protein binding; protein kinase activity
Biological Process: protein modification process
Research Articles on CDKL3
Similar Products
Product Notes
The CDKL3 cdkl3 (Catalog #AAA1266502) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagatgt atgaaaccct tggaaaagtg ggagagggaa gttacggaac agtcatgaaa tgtaaacata agaatactgg gcagatagtg gccattaaga tattttatga gagaccagaa caatctgtca acaaaattgc gatgagagaa ataaagtttc taaagcaatt tcatcacgaa aacctggtca atctgattga agtttttaga cagaaaaaga aaattcattt ggtatttgaa tttattgacc acacagtatt agatgagtta caacattatt gtcatggact agagagtaag cgacttagaa aatacctctt ccagatcctt cgagcaattg actatcttca cagtaataat atcattcatc gagatataaa acctgagaat attttagtat cccagtcagg aattactaag ctctgtgatt ttggttttgc acgaacacta gcagctcctg gggacattta tacggactat gtggccacac gctggtatag agctcccgaa ttagtattaa aagatacttc ttatggaaaa cctgtggata tctgggcttt gggctgtatg atcattgaga tggccactgg aaatccctat cttcctagta gttctgattt ggatttactc cataaaattg ttttgaaagt gggcaatttg tcacctcact tgcagaatat cttttccaag agccccattt ttgctggggt agttcttcct caagttcaac accccaaaaa tgcaagaaaa aaatatccaa agcttaatgg attgttggca gatatagttc atgcttgttt acaaattgat cctgctgaca ggatatcatc tagtgatctt ttgcatcatg agtattttac tagagatgga tttattgaaa aattcatgcc agaactgaaa gctaaattac tgcaggaagc aaaagtcaat tcattaataa agccaaaaga gagttctaaa gaaaatgaac tcaggaaaga tgaaagaaaa acagtttata ccaatacact gctaagtagt tcagttttgg gaaaggaaat agaaaaagag aaaaagccca aggagatcaa agtcagagtt attaaagtca aaggaggaag aggagatatc tcagaaccaa aaaagaaaga gtatgaaggt ggacttggtc aacaggatgc aaatgaaaat gttcatccta tgtctccaga tacaaaactt gtaaccattg aaccaccaaa ccctatcaat cccagcacta actgtaatgg cttgaaagaa aatccacatt gcggaggttc tgtgacaatg ccacccatca atctaactaa cagtaatttg atggctgcaa atctcagttc aaatctcttt caccccagtg tgaggttaac tgaaagagca aaaaagagac gcacttcttc acaatctatt ggacaagtta tgcctaatag caggcaagag gatccaggtc ctattcaaag ccaaatggag aagggtatat ttaatgagcg aacaggtcac agtgaccaaa tggcaaatga gaacaaaagg aagctgaatt tttccagatc tgacaggaaa gaattccatt ttccagaatt gcctgtcaca atacagtcaa aagatacaaa aggaatggaa gttaaacaga taaaaatgct gaagagggag tcaaagaaaa cagagtcatc taagatacca actttactta acgtggatca aaatcaagaa aaacaagagg gtggagatgg ccattgcgag gggaagaatt tgaagagaaa caggtttttt ttctggtag. It is sometimes possible for the material contained within the vial of "CDKL3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
