Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FANCL cdna clone

FANCL cDNA Clone

Gene Names
FANCL; POG; PHF9; FAAP43
Synonyms
FANCL; FANCL cDNA Clone; FANCL cdna clone
Ordering
For Research Use Only!
Sequence
atggcggtgacggaagcgagcctgttgcgccagtgccccctgcttctgccccagaaccggtcgaaaaccgtgtatgagggattcatctcggctcagggaagagacttccaccttaggatagtgttgcctgaagatttacaactgaagaatgcaagattattatgtagttggcagctgagaacaatacttagtggataccatcgaatagtacaacagagaatgcagcactctcctgatctaatgagctttatgatggagttgaagatgcttttggaagttgccttaaagaatagacaagagctgtatgcactacctcctcctccccagttctactcaagccttattgaagagataggaactcttggttgggataaacttgtgtatgcggatacctgcttcagtaccatcaagttaaaagcagaagatgcttctggtagagagcatttaatcactctcaagttgaaggcaaagtatcctgcagaatcaccagattattttgtggattttcctgttccattttgtgcctcctggacacctcagagctccttaataagcatttatagtcagtttttggcagcaatagaatcactaaaggcattctgggatgttatggatgaaatcgatgagaagacctgggtacttgagccagaaaaacctccacggagtgcaacagcacgcagaattgcattaggtaataatgtttccataaatatagaggtagaccccaggcatcctactatgcttcctgagtgcttctttcttggagctgaccatgtggtaaaacccctgggaattaagctgagcaggaacatacatttgtgggatccagaaaatagtgtgttacaaaatttgaaagatgttttagaaattgattttccagctcgtgctatcctggaaaaatctgattttactatggattgtggaatttgttatgcttatcaacttgacggtaccattcctgatcaagtgtgtgataattcccagtgtggacaacctttccatcaaatatgcttatatgagtggctgagaggactactaactagtagacagagttttaacatcatatttggtgaatgtccatattgtagtaagccaattaccttaaaaatgtctggaaggaaacactga
Sequence Length
1128
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,430 Da
NCBI Official Full Name
Homo sapiens Fanconi anemia, complementation group L, mRNA
NCBI Official Synonym Full Names
Fanconi anemia complementation group L
NCBI Official Symbol
FANCL
NCBI Official Synonym Symbols
POG; PHF9; FAAP43
NCBI Protein Information
E3 ubiquitin-protein ligase FANCL
UniProt Protein Name
E3 ubiquitin-protein ligase FANCL
UniProt Gene Name
FANCL
UniProt Synonym Gene Names
PHF9; FAAP43
UniProt Entry Name
FANCL_HUMAN

NCBI Description

The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group L. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

FANCL: Ubiquitin ligase protein that mediates monoubiquitination of FANCD2, a key step in the DNA damage pathway. Also mediates monoubiquitination of FANCI. May stimulate the ubiquitin release from UBE2W. May be required for proper primordial germ cell proliferation in the embryonic stage, whereas it is probably not needed for spermatogonial proliferation after birth. Defects in FANCL are the cause of Fanconi anemia complementation group L (FANCL). FANCL is a disorder affecting all bone marrow elements and resulting in anemia, leukopenia and thrombopenia. It is associated with cardiac, renal and limb malformations, dermal pigmentary changes, and a predisposition to the development of malignancies. At the cellular level it is associated with hypersensitivity to DNA-damaging agents, chromosomal instability (increased chromosome breakage) and defective DNA repair. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ligase; Ubiquitin ligase; Ubiquitin conjugating system; EC 6.3.2.-; EC 6.3.2.19

Chromosomal Location of Human Ortholog: 2p16.1

Cellular Component: nucleoplasm

Molecular Function: protein binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: DNA repair; positive regulation of defense response to virus by host; protein monoubiquitination; response to DNA damage stimulus

Disease: Fanconi Anemia, Complementation Group L; Tracheoesophageal Fistula With Or Without Esophageal Atresia

Research Articles on FANCL

Similar Products

Product Notes

The FANCL fancl (Catalog #AAA1266483) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggtga cggaagcgag cctgttgcgc cagtgccccc tgcttctgcc ccagaaccgg tcgaaaaccg tgtatgaggg attcatctcg gctcagggaa gagacttcca ccttaggata gtgttgcctg aagatttaca actgaagaat gcaagattat tatgtagttg gcagctgaga acaatactta gtggatacca tcgaatagta caacagagaa tgcagcactc tcctgatcta atgagcttta tgatggagtt gaagatgctt ttggaagttg ccttaaagaa tagacaagag ctgtatgcac tacctcctcc tccccagttc tactcaagcc ttattgaaga gataggaact cttggttggg ataaacttgt gtatgcggat acctgcttca gtaccatcaa gttaaaagca gaagatgctt ctggtagaga gcatttaatc actctcaagt tgaaggcaaa gtatcctgca gaatcaccag attattttgt ggattttcct gttccatttt gtgcctcctg gacacctcag agctccttaa taagcattta tagtcagttt ttggcagcaa tagaatcact aaaggcattc tgggatgtta tggatgaaat cgatgagaag acctgggtac ttgagccaga aaaacctcca cggagtgcaa cagcacgcag aattgcatta ggtaataatg tttccataaa tatagaggta gaccccaggc atcctactat gcttcctgag tgcttctttc ttggagctga ccatgtggta aaacccctgg gaattaagct gagcaggaac atacatttgt gggatccaga aaatagtgtg ttacaaaatt tgaaagatgt tttagaaatt gattttccag ctcgtgctat cctggaaaaa tctgatttta ctatggattg tggaatttgt tatgcttatc aacttgacgg taccattcct gatcaagtgt gtgataattc ccagtgtgga caacctttcc atcaaatatg cttatatgag tggctgagag gactactaac tagtagacag agttttaaca tcatatttgg tgaatgtcca tattgtagta agccaattac cttaaaaatg tctggaagga aacactga. It is sometimes possible for the material contained within the vial of "FANCL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.