Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

APOA4 cdna clone

APOA4 cDNA Clone

Synonyms
APOA4; APOA4 cDNA Clone; APOA4 cdna clone
Ordering
For Research Use Only!
Sequence
atgttcctgaaggccgtggtcctgaccctggccctggtggctgtcgccggagccagggctgaggtcagtgctgaccaggtggccacagtgatgtgggactacttcagccagctgagcaacaatgccaaggaggccgtggaacatctccagaaatctgaactcacccagcaactcaatgccctcttccaggacaaacttggggaagtgaacacttacgcaggtgacctgcagaagaagctggtgccctttgccaccgagctgcatgaacgcctggccaaggactcggagaaactgaaggaggagattgggaaggagctggaggagctgagggcccggctgctgccccatgccaatgaggtgagccagaagatcggggacaacctgcgagagcttcagcagcgcctggagccctacgcggaccagctgcgcacccaggtcaacacgcaggccgagcagctgcggcgccagctgaccccctacgcacagcgcatggagagagtgctgcgggagaacgccgacagcctgcaggcctcgctgaggccccacgccgacgagctcaaggccaagatcgaccagaacgtggaggagctcaagggacgccttacgccctacgctgacgaattcaaagtcaagattgaccagaccgtggaggagctgcgccgcagcctggctccctatgctcaggacacgcaggagaagctcaaccaccagcttgagggcctgaccttccagatgaagaagaacgccgaggagctcaaggccaggatctcggccagtgccgaggagctgcggcagaggctggcgcccttggccgaggacgtgcgtggcaacctgaggggcaacaccgaggggctgcagaagtcactggcagagctgggtgggcacctggaccagcaggtggaggagttccgacgccgggtggagccctacggggaaaacttcaacaaagccctggtgcagcagatggaacagctcaggcagaaactgggcccccatgcgggggacgtggaaggccacttgagcttcctggagaaggacctgagggacaaggtcaactccttcttcagcaccttcaaggagaaagagagccaggacaagactctctccctccctgagctggagcaacagcaggaacagcagcaggagcagcagcaggagcaggtgcagatgctggcccctttggagagctga
Sequence Length
1191
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
337
Molecular Weight
45,399 Da
NCBI Official Full Name
Homo sapiens apolipoprotein A-IV, mRNA
NCBI Official Synonym Full Names
apolipoprotein A4
NCBI Official Symbol
APOA4
NCBI Protein Information
apolipoprotein A-IV
UniProt Protein Name
Apolipoprotein A-IV
Protein Family
UniProt Gene Name
APOA4
UniProt Synonym Gene Names
Apo-AIV; ApoA-IV
UniProt Entry Name
APOA4_HUMAN

NCBI Description

Apoliprotein (apo) A-IV gene contains 3 exons separated by two introns. A sequence polymorphism has been identified in the 3'UTR of the third exon. The primary translation product is a 396-residue preprotein which after proteolytic processing is secreted its primary site of synthesis, the intestine, in association with chylomicron particles. Although its precise function is not known, apo A-IV is a potent activator of lecithin-cholesterol acyltransferase in vitro. [provided by RefSeq, Jul 2008]

Uniprot Description

APOA4: May have a role in chylomicrons and VLDL secretion and catabolism. Required for efficient activation of lipoprotein lipase by ApoC-II; potent activator of LCAT. Apoa-IV is a major component of HDL and chylomicrons. Synthesized primarily in the intestine and secreted in plasma. Belongs to the apolipoprotein A1/A4/E family.

Protein type: Lipid-binding; Secreted, signal peptide; Secreted; Cell adhesion; Endoplasmic reticulum

Chromosomal Location of Human Ortholog: 11q23

Cellular Component: cell surface; chylomicron; cytosol; early endosome; endoplasmic reticulum lumen; extracellular region; extracellular space

Molecular Function: antioxidant activity; cholesterol binding; cholesterol transporter activity; copper ion binding; lipid binding; lipid transporter activity; phosphatidylcholine binding; protein binding; protein homodimerization activity

Biological Process: cellular protein metabolic process; cholesterol biosynthetic process; cholesterol efflux; cholesterol homeostasis; cholesterol metabolic process; hydrogen peroxide catabolic process; innate immune response in mucosa; leukocyte adhesion; lipid homeostasis; lipid transport; lipoprotein biosynthetic process; lipoprotein metabolic process; multicellular organismal lipid catabolic process; neurite regeneration; phosphatidylcholine metabolic process; phospholipid efflux; positive regulation of fatty acid biosynthetic process; positive regulation of lipoprotein lipase activity; protein-lipid complex assembly; regulation of cholesterol absorption; regulation of cholesterol transport; removal of superoxide radicals; response to lipid hydroperoxide; retinoid metabolic process; reverse cholesterol transport

Research Articles on APOA4

Similar Products

Product Notes

The APOA4 apoa4 (Catalog #AAA1266300) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttcctga aggccgtggt cctgaccctg gccctggtgg ctgtcgccgg agccagggct gaggtcagtg ctgaccaggt ggccacagtg atgtgggact acttcagcca gctgagcaac aatgccaagg aggccgtgga acatctccag aaatctgaac tcacccagca actcaatgcc ctcttccagg acaaacttgg ggaagtgaac acttacgcag gtgacctgca gaagaagctg gtgccctttg ccaccgagct gcatgaacgc ctggccaagg actcggagaa actgaaggag gagattggga aggagctgga ggagctgagg gcccggctgc tgccccatgc caatgaggtg agccagaaga tcggggacaa cctgcgagag cttcagcagc gcctggagcc ctacgcggac cagctgcgca cccaggtcaa cacgcaggcc gagcagctgc ggcgccagct gaccccctac gcacagcgca tggagagagt gctgcgggag aacgccgaca gcctgcaggc ctcgctgagg ccccacgccg acgagctcaa ggccaagatc gaccagaacg tggaggagct caagggacgc cttacgccct acgctgacga attcaaagtc aagattgacc agaccgtgga ggagctgcgc cgcagcctgg ctccctatgc tcaggacacg caggagaagc tcaaccacca gcttgagggc ctgaccttcc agatgaagaa gaacgccgag gagctcaagg ccaggatctc ggccagtgcc gaggagctgc ggcagaggct ggcgcccttg gccgaggacg tgcgtggcaa cctgaggggc aacaccgagg ggctgcagaa gtcactggca gagctgggtg ggcacctgga ccagcaggtg gaggagttcc gacgccgggt ggagccctac ggggaaaact tcaacaaagc cctggtgcag cagatggaac agctcaggca gaaactgggc ccccatgcgg gggacgtgga aggccacttg agcttcctgg agaaggacct gagggacaag gtcaactcct tcttcagcac cttcaaggag aaagagagcc aggacaagac tctctccctc cctgagctgg agcaacagca ggaacagcag caggagcagc agcaggagca ggtgcagatg ctggcccctt tggagagctg a. It is sometimes possible for the material contained within the vial of "APOA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.