VWA5A cdna clone
VWA5A cDNA Clone
Gene Names
VWA5A; BCSC1; BCSC-1; LOH11CR2A
Synonyms
VWA5A; VWA5A cDNA Clone; VWA5A cdna clone
Sequence
atggtgcacttctgtggcctactcaccctccaccgggagccagtgccgctgaagagtatctctgtgagcgtgaacatttacgagtttgtggctggtgtgtctgcaactttgaactacgagaatgaggagaaagttcctttggaggccttctttgtgttccccatggatgaagactctgctgtttacagctttgaggccttggtggatgggaagaaaattgtagcagaattacaagacaagatgaaggcccgcaccaactatgagaaagccatctcccagggccaccaggccttcttattggagggggacagcagctccagggatgtcttctcttgcaatgtgggtaacctccaacctgggtcgaaggcggcagtcaccctgaagtatgtgcaggagctgcctctggaagcagatggggctctgcgctttgtgctcccagctgtcctgaatcctagataccagttctctgggtcgtctaaggacagttgccttaatgtgaagactcctatagtccctgtggaggacctgccctacacactcagcatggtcgccaccatagattcccagcatggcattgagaaggtccaatccaactgccccttgagtcctaccgagtacctaggagaggacaagacttctgctcaggtttccctggctgctggacacaagtttgatcgggacgtggaactcctgatttactacaatgaggtgcatacccccagcgtggttttggagatggggatgcctaacatgaagccaggtcatttgatgggagatccatctgcaatggtgagtttctatccaaatatcccagaagatcaaccatcaaatacctgtggagagtttatctttctcatggaccgctcgggaagtatgcagagccccatgagtagccaggatacatctcagctgcgaatacaggcagccaaggaaacactgattttgctgctgaagagtttacctataggctgttatttcaacatctatggatttggctcttcctatgaggcatgctttccggagagtgtgaagtacactcagcaaacaatggaggaggctctggggagagtgaagcttatgcaggccgacctagggggcactgaaatcttggcaccactccagaacatttacaggggaccctccatcccaggccaccccctacagctttttgtctttacagatggagaagttacagacacgtttagtgtaattaaagaagttaggatcaacagacagaaacacaggtag
Sequence Length
1248
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
29,235 Da
NCBI Official Full Name
Homo sapiens von Willebrand factor A domain containing 5A, mRNA
NCBI Official Synonym Full Names
von Willebrand factor A domain containing 5A
NCBI Official Symbol
VWA5A
NCBI Official Synonym Symbols
BCSC1; BCSC-1; LOH11CR2A
NCBI Protein Information
von Willebrand factor A domain-containing protein 5A
UniProt Protein Name
von Willebrand factor A domain-containing protein 5A
Protein Family
UniProt Gene Name
VWA5A
UniProt Synonym Gene Names
BCSC1; LOH11CR2A; BCSC-1
UniProt Entry Name
VMA5A_HUMAN
Uniprot Description
VWA5A: May play a role in tumorigenesis as a tumor suppressor. Altered expression of this protein and disruption of the molecular pathway it is involved in, may contribute directly to or modify tumorigenesis. 4 isoforms of the human protein are produced by alternative splicing.
Protein type: Tumor suppressor
Chromosomal Location of Human Ortholog: 11q24.1
Cellular Component: nucleoplasm; nucleus
Research Articles on VWA5A
Similar Products
Product Notes
The VWA5A vwa5a (Catalog #AAA1266256) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgcact tctgtggcct actcaccctc caccgggagc cagtgccgct gaagagtatc tctgtgagcg tgaacattta cgagtttgtg gctggtgtgt ctgcaacttt gaactacgag aatgaggaga aagttccttt ggaggccttc tttgtgttcc ccatggatga agactctgct gtttacagct ttgaggcctt ggtggatggg aagaaaattg tagcagaatt acaagacaag atgaaggccc gcaccaacta tgagaaagcc atctcccagg gccaccaggc cttcttattg gagggggaca gcagctccag ggatgtcttc tcttgcaatg tgggtaacct ccaacctggg tcgaaggcgg cagtcaccct gaagtatgtg caggagctgc ctctggaagc agatggggct ctgcgctttg tgctcccagc tgtcctgaat cctagatacc agttctctgg gtcgtctaag gacagttgcc ttaatgtgaa gactcctata gtccctgtgg aggacctgcc ctacacactc agcatggtcg ccaccataga ttcccagcat ggcattgaga aggtccaatc caactgcccc ttgagtccta ccgagtacct aggagaggac aagacttctg ctcaggtttc cctggctgct ggacacaagt ttgatcggga cgtggaactc ctgatttact acaatgaggt gcataccccc agcgtggttt tggagatggg gatgcctaac atgaagccag gtcatttgat gggagatcca tctgcaatgg tgagtttcta tccaaatatc ccagaagatc aaccatcaaa tacctgtgga gagtttatct ttctcatgga ccgctcggga agtatgcaga gccccatgag tagccaggat acatctcagc tgcgaataca ggcagccaag gaaacactga ttttgctgct gaagagttta cctataggct gttatttcaa catctatgga tttggctctt cctatgaggc atgctttccg gagagtgtga agtacactca gcaaacaatg gaggaggctc tggggagagt gaagcttatg caggccgacc tagggggcac tgaaatcttg gcaccactcc agaacattta caggggaccc tccatcccag gccaccccct acagcttttt gtctttacag atggagaagt tacagacacg tttagtgtaa ttaaagaagt taggatcaac agacagaaac acaggtag. It is sometimes possible for the material contained within the vial of "VWA5A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
