Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EIF4B cdna clone

EIF4B cDNA Clone

Gene Names
EIF4B; EIF-4B; PRO1843
Synonyms
EIF4B; EIF4B cDNA Clone; EIF4B cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcctcagcaaaaaagaagaataagaaggggaagactatctccctaacagactttctggctgaggatgggggtactggtggaggaagcacctatgtttccaaaccagtcagctgggctgatgaaacggatgacctggaaggagatgtttcgaccacttggcacagtaacgatgacgatgtgtatagggcgcctccaattgaccgttccatccttcccactgctccacgggctgctcgggaacccaatatcgaccggagccgtcttcccaaatcgccaccctacactgcttttctaggaaacctaccctatgatgttacagaagagtcaattaaggaattctttcgaggattaaatatcagtgcagtgcgtttaccacgtgaacccagcaatccagagaggttgaaaggttttggttatgctgaatttgaggacctggattccctgctcagtgccctgagtctcaatgaagagtctctaggtaacaggagaattcgagtggacgttgctgatcaagcacaggataaagacagggatgatcgttcttttggccgtgatagaaatcgggattctgacaaaacagatacagactggagggctcgtcctgctacagacagctttgatgactacccacctagaagaggtgatgatagctttggagacaagtatcgagatcgttatgattcagaccggtatcgggatgggtatcgggatgggtatcgggatggcccacgccgggatatggatcgatatggtggccgggatcgctatgatgaccgaggcagcagagactatgatagaggctatgattcccggataggcagtggcagaagagcatttggcagtgggtatcgcagggatgatgactacagaggaggcggggaccgctatgaagaccgatatgacagacgggatgatcggtcgtggagctccagagatgattactctcgggatgattataggcgtgatgatagaggtcccccccaaagacccaaactgaatctaaagcctcggagtactcctaaggaagatgattcctctgctagtacctcccagtccactcgagctgcttctatctttggaggggcaaagcctgttgacacagctgctagagaaagagaagtagaagaacggctacagaaggaacaagagaagttgcagcgtcagctggatgagccaaaactagaacgacggcctcgggagagacacccaagctggcgaagtgaagaaactcaggaacgggaacggtcgaggacaggaagtgagtcatcacaaactgggacctccaccacatctagcagaaatgcacgaaggagagagagtgagaagtctctagaaaatgaaacactcaataaggaggaagattgccactctccaacttctaaacctcccaaacctgatcagcccctaaaggtaatgccagcccctccaccaaaggagaatgcttgggtgaagcgaagttctaaccctcctgctcgatctcagagctcagacacagagcagcagtcccctacaagtggtgggggaaaagtagctccagctcaaccatctgaggaaggaccaggaaggaaagatgaaaataaagtagatgggatgaatgccccaaaaggccaaactgggaactctagccgtggtccaggagacggagggaacagagaccactggaaggagtcagataggaaagatggcaaaaaggatcaagactccagatctgcacctgagccaaagaaacctgaggaaaatccagcttctaagttcagttctgcaagcaagtatgctgctctctctgttgatggtgaagatgaaaatgagggagaagattatgccgaatag
Sequence Length
1836
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,805 Da
NCBI Official Full Name
Homo sapiens eukaryotic translation initiation factor 4B, mRNA
NCBI Official Synonym Full Names
eukaryotic translation initiation factor 4B
NCBI Official Symbol
EIF4B
NCBI Official Synonym Symbols
EIF-4B; PRO1843
NCBI Protein Information
eukaryotic translation initiation factor 4B
UniProt Protein Name
Eukaryotic translation initiation factor 4B
UniProt Gene Name
EIF4B
UniProt Synonym Gene Names
eIF-4B
UniProt Entry Name
IF4B_HUMAN

Uniprot Description

EIF4B: eukaryotic translation initiation factor 4B. Required for the binding of mRNA to ribosomes. Functions in close association with EIF4-F and EIF4-A. Binds near the 5'-terminal cap of mRNA in presence of EIF-4F and ATP. Promotes the ATPase activity and the ATP-dependent RNA unwinding activity of both EIF4-A and EIF4-F.

Protein type: Translation; RNA-binding; Translation initiation

Chromosomal Location of Human Ortholog: 12q13.13

Cellular Component: cytosol; eukaryotic translation initiation factor 4F complex; polysome

Molecular Function: helicase activity; protein binding; ribosomal small subunit binding; RNA binding; RNA strand annealing activity; RNA strand-exchange activity

Biological Process: formation of translation preinitiation complex; poly(A) tail shortening; regulation of translational initiation; translational initiation

Research Articles on EIF4B

Similar Products

Product Notes

The EIF4B eif4b (Catalog #AAA1266068) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcct cagcaaaaaa gaagaataag aaggggaaga ctatctccct aacagacttt ctggctgagg atgggggtac tggtggagga agcacctatg tttccaaacc agtcagctgg gctgatgaaa cggatgacct ggaaggagat gtttcgacca cttggcacag taacgatgac gatgtgtata gggcgcctcc aattgaccgt tccatccttc ccactgctcc acgggctgct cgggaaccca atatcgaccg gagccgtctt cccaaatcgc caccctacac tgcttttcta ggaaacctac cctatgatgt tacagaagag tcaattaagg aattctttcg aggattaaat atcagtgcag tgcgtttacc acgtgaaccc agcaatccag agaggttgaa aggttttggt tatgctgaat ttgaggacct ggattccctg ctcagtgccc tgagtctcaa tgaagagtct ctaggtaaca ggagaattcg agtggacgtt gctgatcaag cacaggataa agacagggat gatcgttctt ttggccgtga tagaaatcgg gattctgaca aaacagatac agactggagg gctcgtcctg ctacagacag ctttgatgac tacccaccta gaagaggtga tgatagcttt ggagacaagt atcgagatcg ttatgattca gaccggtatc gggatgggta tcgggatggg tatcgggatg gcccacgccg ggatatggat cgatatggtg gccgggatcg ctatgatgac cgaggcagca gagactatga tagaggctat gattcccgga taggcagtgg cagaagagca tttggcagtg ggtatcgcag ggatgatgac tacagaggag gcggggaccg ctatgaagac cgatatgaca gacgggatga tcggtcgtgg agctccagag atgattactc tcgggatgat tataggcgtg atgatagagg tcccccccaa agacccaaac tgaatctaaa gcctcggagt actcctaagg aagatgattc ctctgctagt acctcccagt ccactcgagc tgcttctatc tttggagggg caaagcctgt tgacacagct gctagagaaa gagaagtaga agaacggcta cagaaggaac aagagaagtt gcagcgtcag ctggatgagc caaaactaga acgacggcct cgggagagac acccaagctg gcgaagtgaa gaaactcagg aacgggaacg gtcgaggaca ggaagtgagt catcacaaac tgggacctcc accacatcta gcagaaatgc acgaaggaga gagagtgaga agtctctaga aaatgaaaca ctcaataagg aggaagattg ccactctcca acttctaaac ctcccaaacc tgatcagccc ctaaaggtaa tgccagcccc tccaccaaag gagaatgctt gggtgaagcg aagttctaac cctcctgctc gatctcagag ctcagacaca gagcagcagt cccctacaag tggtggggga aaagtagctc cagctcaacc atctgaggaa ggaccaggaa ggaaagatga aaataaagta gatgggatga atgccccaaa aggccaaact gggaactcta gccgtggtcc aggagacgga gggaacagag accactggaa ggagtcagat aggaaagatg gcaaaaagga tcaagactcc agatctgcac ctgagccaaa gaaacctgag gaaaatccag cttctaagtt cagttctgca agcaagtatg ctgctctctc tgttgatggt gaagatgaaa atgagggaga agattatgcc gaatag. It is sometimes possible for the material contained within the vial of "EIF4B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.