Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IGJ cdna clone

IGJ cDNA Clone

Gene Names
JCHAIN; IGJ; JCH; IGCJ
Synonyms
IGJ; IGJ cDNA Clone; IGJ cdna clone
Ordering
For Research Use Only!
Sequence
atgaagaaccatttgcttttctggggagtcctggcggtttttattaaggctgttcatgtgaaagcccaagaagatgaaaggattgttcttgttgacaacaaatgtaagtgtgcccggattacttccaggatcatccgttcttccgaagatcctaatgaggacattgtggagagaaacatccgaattattgttcctctgaacaacagggagaatatctctgatcccacctcaccattgagaaccagatttgtgtaccatttgtctgacctctgtaaaaaatgtgatcctacagaagtggagctggataatcagatagttactgctacccagagcaatatctgtgatgaagacagtgctacagagacctgctacacttatgacagaaacaagtgctacacagctgtggtcccactcgtatatggtggtgagaccaaaatggtggaaacagccttaaccccagatgcctgctatcctgactaa
Sequence Length
480
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,099 Da
NCBI Official Full Name
Homo sapiens immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides, mRNA
NCBI Official Synonym Full Names
joining chain of multimeric IgA and IgM
NCBI Official Symbol
JCHAIN
NCBI Official Synonym Symbols
IGJ; JCH; IGCJ
NCBI Protein Information
immunoglobulin J chain
UniProt Protein Name
Immunoglobulin J chain
UniProt Gene Name
JCHAIN
UniProt Entry Name
IGJ_HUMAN

Uniprot Description

IGJ: Serves to link two monomer units of either IgM or IgA. In the case of IgM, the J chain-joined dimer is a nucleating unit for the IgM pentamer, and in the case of IgA it induces larger polymers. It also help to bind these immunoglobulins to secretory component.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 4q21

Cellular Component: extracellular region; extracellular space

Molecular Function: IgA binding; peptidoglycan binding; phosphatidylcholine binding; protein homodimerization activity; single-stranded DNA binding

Biological Process: adaptive immune response; antibacterial humoral response; glomerular filtration; innate immune response; positive regulation of protein oligomerization; receptor-mediated endocytosis; retinal homeostasis

Research Articles on IGJ

Similar Products

Product Notes

The IGJ jchain (Catalog #AAA1266038) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagaacc atttgctttt ctggggagtc ctggcggttt ttattaaggc tgttcatgtg aaagcccaag aagatgaaag gattgttctt gttgacaaca aatgtaagtg tgcccggatt acttccagga tcatccgttc ttccgaagat cctaatgagg acattgtgga gagaaacatc cgaattattg ttcctctgaa caacagggag aatatctctg atcccacctc accattgaga accagatttg tgtaccattt gtctgacctc tgtaaaaaat gtgatcctac agaagtggag ctggataatc agatagttac tgctacccag agcaatatct gtgatgaaga cagtgctaca gagacctgct acacttatga cagaaacaag tgctacacag ctgtggtccc actcgtatat ggtggtgaga ccaaaatggt ggaaacagcc ttaaccccag atgcctgcta tcctgactaa. It is sometimes possible for the material contained within the vial of "IGJ, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.