Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RDH5 cdna clone

RDH5 cDNA Clone

Gene Names
RDH5; RDH1; 9cRDH; SDR9C5; HSD17B9
Synonyms
RDH5; RDH5 cDNA Clone; RDH5 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggctgcctcttctgctgggtgccttactctgggcagtgctgtggttgctcagggaccggcagagcctgcccgccagcaatgcccttgtcttcatcaccggctgtgactcaggctttgggcgccttctggcactgcagctggaccagagaggcttccgagtcctggccagctgcctgaccccctccggggccgaggacctgcagcgggtggcctcctcccgcctccacaccaccctgttggatatcactgatccccagagcgtccagcaggcagccaagtgggtggagatgcacgttaaggaagcagggctttttggtctggtgaataatgctggtgtggctggtatcatcggacccacaccatggctgacccgggacgatttccagcgggtgctgaatgtgaacacaatgggtcccatcggggtcacccttgccctgctgcctctgctgcagcaagcccggggccgggtgatcaacatcaccagcgtcctgggtcgcctggcagccaatggtgggggctactgtgtctccaaatttggcctggaggccttctctgacagcctgaggcgggatgtagctcattttgggatacgagtctccatcgtggagcctggcttcttccgaacccctgtgaccaacctggagagtctggagaaaaccctgcaggcctgctgggcacggctgcctcctgccacacaggcccactatgggggggccttcctcaccaagtacctgaaaatgcaacagcgcatcatgaacctgatctgtgacccggacctaaccaaggtgagccgatgcctggagcatgccctgactgctcgacacccccgaacccgctacagcccaggttgggatgccaagctgctctggctgcctgcctcctacctgccagccagcctggtggatgctgtgctcacctgggtccttcccaagcctgcccaagcagtctactga
Sequence Length
957
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,979 Da
NCBI Official Full Name
Homo sapiens retinol dehydrogenase 5 (11-cis/9-cis), mRNA
NCBI Official Synonym Full Names
retinol dehydrogenase 5
NCBI Official Symbol
RDH5
NCBI Official Synonym Symbols
RDH1; 9cRDH; SDR9C5; HSD17B9
NCBI Protein Information
11-cis retinol dehydrogenase
UniProt Protein Name
11-cis retinol dehydrogenase
UniProt Gene Name
RDH5
UniProt Synonym Gene Names
HSD17B9; RDH1; SDR9C5; 11-cis RDH; 11-cis RoDH; 9cRDH
UniProt Entry Name
RDH1_HUMAN

NCBI Description

This gene encodes an enzyme belonging to the short-chain dehydrogenases/reductases (SDR) family. This retinol dehydrogenase functions to catalyze the final step in the biosynthesis of 11-cis retinaldehyde, which is the universal chromophore of visual pigments. Mutations in this gene cause autosomal recessive fundus albipunctatus, a rare form of night blindness that is characterized by a delay in the regeneration of cone and rod photopigments. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S1 (biogenesis of lysosomal organelles complex-1, subunit 1) gene. [provided by RefSeq, Dec 2010]

Uniprot Description

RDH5: Stereospecific 11-cis retinol dehydrogenase, which catalyzes the final step in the biosynthesis of 11-cis retinaldehyde, the universal chromophore of visual pigments. Also able to oxidize 9-cis-retinol and 13-cis-retinol, but not all- trans-retinol. Active in the presence of NAD as cofactor but not in the presence of NADP. Defects in RDH5 are a cause of retinitis punctata albescens (RPA); also known as fundus albipunctatus (FA). RPA is a rare form of stationary night blindness characterized by a delay in the regeneration of cone and rod photopigments. Belongs to the short-chain dehydrogenases/reductases (SDR) family.

Protein type: Oxidoreductase; Cofactor and Vitamin Metabolism - retinol; Endoplasmic reticulum; EC 1.1.1.315

Chromosomal Location of Human Ortholog: 12q13-q14

Cellular Component: endoplasmic reticulum membrane

Molecular Function: retinol dehydrogenase activity

Biological Process: retinoid metabolic process

Disease: Fundus Albipunctatus

Research Articles on RDH5

Similar Products

Product Notes

The RDH5 rdh5 (Catalog #AAA1265782) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggctgc ctcttctgct gggtgcctta ctctgggcag tgctgtggtt gctcagggac cggcagagcc tgcccgccag caatgccctt gtcttcatca ccggctgtga ctcaggcttt gggcgccttc tggcactgca gctggaccag agaggcttcc gagtcctggc cagctgcctg accccctccg gggccgagga cctgcagcgg gtggcctcct cccgcctcca caccaccctg ttggatatca ctgatcccca gagcgtccag caggcagcca agtgggtgga gatgcacgtt aaggaagcag ggctttttgg tctggtgaat aatgctggtg tggctggtat catcggaccc acaccatggc tgacccggga cgatttccag cgggtgctga atgtgaacac aatgggtccc atcggggtca cccttgccct gctgcctctg ctgcagcaag cccggggccg ggtgatcaac atcaccagcg tcctgggtcg cctggcagcc aatggtgggg gctactgtgt ctccaaattt ggcctggagg ccttctctga cagcctgagg cgggatgtag ctcattttgg gatacgagtc tccatcgtgg agcctggctt cttccgaacc cctgtgacca acctggagag tctggagaaa accctgcagg cctgctgggc acggctgcct cctgccacac aggcccacta tgggggggcc ttcctcacca agtacctgaa aatgcaacag cgcatcatga acctgatctg tgacccggac ctaaccaagg tgagccgatg cctggagcat gccctgactg ctcgacaccc ccgaacccgc tacagcccag gttgggatgc caagctgctc tggctgcctg cctcctacct gccagccagc ctggtggatg ctgtgctcac ctgggtcctt cccaagcctg cccaagcagt ctactga. It is sometimes possible for the material contained within the vial of "RDH5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.