IKZF5 cdna clone
IKZF5 cDNA Clone
Gene Names
IKZF5; PEGASUS; ZNFN1A5
Synonyms
IKZF5; IKZF5 cDNA Clone; IKZF5 cdna clone
Sequence
atgggtgaaaaaaaaccagagcctttggacttcgtgaaagattttcaggaatacctgactcagcagacccatcacgtgaacatgatttctggatcagttagtggggacaaagaagcagaggctcttcagggagctggaacagatggtgatcaaaatggacttgatcacccatctgttgaagtttccttggatgaaaactcaggaatgttagtagacgggtttgaaaggacctttgatgggaagcttaagtgtcggtactgcaactatgccagcaaaggaacagcccggcttattgaacacatcagaatccacacaggtgaaaaacctcatcgatgtcatctttgtccatttgcatctgcttatgagcgtcatctggaagcccatatgcgttctcatactggagaaaaaccatacaaatgtgaattatgttccttccgctgcagtgatcgaagtaacttgtcccatcatcgaaggcgcaagcataaaatggtaccaattaaaggtactaggtcttccttaagcagcaagaaaatgtggggggttttacagaagaaaacaagcaatctgggctatagcagaagagcactaatcaacttaagtccaccttccgtggtggttcagaaaccagactaccttaacgattttacccacgaaatcccaaatatccagactgactcctatgaaagtatggcaaaaaccacaccaactggtggccttccaagggacccccaagaactcatggttgataaccctttgaatcagctctcgactctagcagggcagttgtccagtctgccacccgaaaaccaaaaccctgcatcacctgatgtagttccctgccctgatgaaaagcctttcatgattcagcagccctctacccaagcagtagtttctgccgtatcagcaagtattcctcagagctcctctcccacaagcccagaacctcggccatcccatagtcaaaggaactatagtccagtggcaggtccaagcagtgagccaagtgcccacacgagcactcccagcataggaaacagccagccaagcaccccagccccagccctgccggtccaggaccctcagcttctgcaccactgccagcactgtgatatgtactttgcagacaacatcctttacactattcatatgggatgtcatgggtatgaaaatccttttcagtgtaatatatgtggatgcaaatgtaaaaacaagtatgattttgcctgtcattttgcaagagggcacataaccaacattgattga
Sequence Length
1263
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
46,510 Da
NCBI Official Full Name
Homo sapiens IKAROS family zinc finger 5 (Pegasus), mRNA
NCBI Official Synonym Full Names
IKAROS family zinc finger 5
NCBI Official Symbol
IKZF5
NCBI Official Synonym Symbols
PEGASUS; ZNFN1A5
NCBI Protein Information
zinc finger protein Pegasus
UniProt Protein Name
Zinc finger protein Pegasus
Protein Family
UniProt Gene Name
IKZF5
UniProt Synonym Gene Names
ZNFN1A5
UniProt Entry Name
IKZF5_HUMAN
NCBI Description
Members of the Ikaros (ZNFN1A1; MIM 603023) family of transcription factors, which includes Pegasus, are expressed in lymphocytes and are implicated in the control of lymphoid development.[supplied by OMIM, Jul 2002]
Uniprot Description
IKZF5: DNA-binding protein that binds to the 5'GNNTGTNG-3' core sequence. Transcriptional repressor. Belongs to the Ikaros C2H2-type zinc-finger protein family.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 10q26
Molecular Function: transcription factor activity
Biological Process: regulation of transcription, DNA-dependent
Similar Products
Product Notes
The IKZF5 ikzf5 (Catalog #AAA1265627) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtgaaa aaaaaccaga gcctttggac ttcgtgaaag attttcagga atacctgact cagcagaccc atcacgtgaa catgatttct ggatcagtta gtggggacaa agaagcagag gctcttcagg gagctggaac agatggtgat caaaatggac ttgatcaccc atctgttgaa gtttccttgg atgaaaactc aggaatgtta gtagacgggt ttgaaaggac ctttgatggg aagcttaagt gtcggtactg caactatgcc agcaaaggaa cagcccggct tattgaacac atcagaatcc acacaggtga aaaacctcat cgatgtcatc tttgtccatt tgcatctgct tatgagcgtc atctggaagc ccatatgcgt tctcatactg gagaaaaacc atacaaatgt gaattatgtt ccttccgctg cagtgatcga agtaacttgt cccatcatcg aaggcgcaag cataaaatgg taccaattaa aggtactagg tcttccttaa gcagcaagaa aatgtggggg gttttacaga agaaaacaag caatctgggc tatagcagaa gagcactaat caacttaagt ccaccttccg tggtggttca gaaaccagac taccttaacg attttaccca cgaaatccca aatatccaga ctgactccta tgaaagtatg gcaaaaacca caccaactgg tggccttcca agggaccccc aagaactcat ggttgataac cctttgaatc agctctcgac tctagcaggg cagttgtcca gtctgccacc cgaaaaccaa aaccctgcat cacctgatgt agttccctgc cctgatgaaa agcctttcat gattcagcag ccctctaccc aagcagtagt ttctgccgta tcagcaagta ttcctcagag ctcctctccc acaagcccag aacctcggcc atcccatagt caaaggaact atagtccagt ggcaggtcca agcagtgagc caagtgccca cacgagcact cccagcatag gaaacagcca gccaagcacc ccagccccag ccctgccggt ccaggaccct cagcttctgc accactgcca gcactgtgat atgtactttg cagacaacat cctttacact attcatatgg gatgtcatgg gtatgaaaat ccttttcagt gtaatatatg tggatgcaaa tgtaaaaaca agtatgattt tgcctgtcat tttgcaagag ggcacataac caacattgat tga. It is sometimes possible for the material contained within the vial of "IKZF5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
