Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF572 cdna clone

ZNF572 cDNA Clone

Synonyms
ZNF572; ZNF572 cDNA Clone; ZNF572 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcaagaaaaaaaactgttggtctcagattctaacagctttatggagagggagagtttgaaaagccctttcacaggagatacaagtatgaataatttggaaactgttcaccacaataattctaaggcagataaacttaaagagaaaccttcagaatggtctaaaagacatagaccacaacattataagcatgaggatgcaaaagaaatgccactgacatgggttcaagatgagatttggtgtcatgattcctatgagagtgatggcaagtcagagaattggggaaattttatagctaaagaggaggaaaaacccaatcaccaggaatgggactcaggagaacataccaatgcctgtgtccagcagaattcatcctttgtagacagaccctataaatgttccgaatgttggaaaagcttcagtaatagttctcatttgcgtactcaccagaggacccactcaggagaaaagccttataaatgctctgagtgtgcaaaatgtttttgtaacagttctcacctgattcagcatctaagaatgcacacaggagagaagccctaccagtgtggtgaatgtgggaaaagcttcagcaatacctcccatcttattatccatgagagaactcacacgggagagaaaccctacaaatgtcccgagtgtgggaagagattcagcagcagctctcaccttattcagcatcacagatcacatacaggtgaaaaaccatatgaatgttctgtctgcggaaaaggcttcagtcacagctatgtcctaatagaacatcagaggactcacactggagaaaaaccttataagtgccctgattgtgggaagagttttagtcagagttccagcctcattcgccaccagcggacacacacaggtgagaagccctacaaatgtcttgagtgtgaaaaaagctttggttgtaattctactctaataaaacatcagagaatacatacaggagaaaagccttatcaatgtccagaatgtgggaagaattttagtcgtagttcaaaccttattacacaccagaaaatgcacacaggagagaaatcctatgaaagttctgaatatgaggaaagtttgggtcagaactgcaatgtgatagaagaatgcagaatccagttaggagagaaaccatatagatgttgtgaatgtgggaagagttttggccttagctcccatctcattagacatcagagaacacatacaggagaaaaaccttacagatgttctgagtgctggaaaactttcagtcagagttccaccctggtgattcaccaaaggacacatacaggagagaaaccttataaatgtcctgattgtggtgaaagcttcagtcagagctttaaccttatcaggcaccggaggacccacataggggaaaaaccttacaaatgtaccagctgtgagaaatgcttcagcagaagtgcctacctcagtcagcatcggaaaattcacgtagaaaagccttttgagtctcccgacgttggggattttcctcatgaatggacttggaaaaactgttcaggggaaatgcccttcatctcttcattttccgtctcaaattcatcttcctga
Sequence Length
1590
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,238 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 572, mRNA
NCBI Official Synonym Full Names
zinc finger protein 572
NCBI Official Symbol
ZNF572
NCBI Protein Information
zinc finger protein 572
UniProt Protein Name
Zinc finger protein 572
Protein Family
UniProt Gene Name
ZNF572
UniProt Entry Name
ZN572_HUMAN

Uniprot Description

ZNF572: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 8q24.13

Cellular Component: nucleus

Molecular Function: protein binding

Similar Products

Product Notes

The ZNF572 znf572 (Catalog #AAA1274254) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcaag aaaaaaaact gttggtctca gattctaaca gctttatgga gagggagagt ttgaaaagcc ctttcacagg agatacaagt atgaataatt tggaaactgt tcaccacaat aattctaagg cagataaact taaagagaaa ccttcagaat ggtctaaaag acatagacca caacattata agcatgagga tgcaaaagaa atgccactga catgggttca agatgagatt tggtgtcatg attcctatga gagtgatggc aagtcagaga attggggaaa ttttatagct aaagaggagg aaaaacccaa tcaccaggaa tgggactcag gagaacatac caatgcctgt gtccagcaga attcatcctt tgtagacaga ccctataaat gttccgaatg ttggaaaagc ttcagtaata gttctcattt gcgtactcac cagaggaccc actcaggaga aaagccttat aaatgctctg agtgtgcaaa atgtttttgt aacagttctc acctgattca gcatctaaga atgcacacag gagagaagcc ctaccagtgt ggtgaatgtg ggaaaagctt cagcaatacc tcccatctta ttatccatga gagaactcac acgggagaga aaccctacaa atgtcccgag tgtgggaaga gattcagcag cagctctcac cttattcagc atcacagatc acatacaggt gaaaaaccat atgaatgttc tgtctgcgga aaaggcttca gtcacagcta tgtcctaata gaacatcaga ggactcacac tggagaaaaa ccttataagt gccctgattg tgggaagagt tttagtcaga gttccagcct cattcgccac cagcggacac acacaggtga gaagccctac aaatgtcttg agtgtgaaaa aagctttggt tgtaattcta ctctaataaa acatcagaga atacatacag gagaaaagcc ttatcaatgt ccagaatgtg ggaagaattt tagtcgtagt tcaaacctta ttacacacca gaaaatgcac acaggagaga aatcctatga aagttctgaa tatgaggaaa gtttgggtca gaactgcaat gtgatagaag aatgcagaat ccagttagga gagaaaccat atagatgttg tgaatgtggg aagagttttg gccttagctc ccatctcatt agacatcaga gaacacatac aggagaaaaa ccttacagat gttctgagtg ctggaaaact ttcagtcaga gttccaccct ggtgattcac caaaggacac atacaggaga gaaaccttat aaatgtcctg attgtggtga aagcttcagt cagagcttta accttatcag gcaccggagg acccacatag gggaaaaacc ttacaaatgt accagctgtg agaaatgctt cagcagaagt gcctacctca gtcagcatcg gaaaattcac gtagaaaagc cttttgagtc tcccgacgtt ggggattttc ctcatgaatg gacttggaaa aactgttcag gggaaatgcc cttcatctct tcattttccg tctcaaattc atcttcctga. It is sometimes possible for the material contained within the vial of "ZNF572, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.