Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF503 cdna clone

ZNF503 cDNA Clone

Gene Names
ZNF503; Nlz2; NOLZ1; NOLZ-1
Synonyms
ZNF503; ZNF503 cDNA Clone; ZNF503 cdna clone
Ordering
For Research Use Only!
Sequence
atgagcacagcgccctcgctttctgccctaagaagcagtaagcacagcggcggcggcggcggcggcggcggaggcggcggtgcagaccctgcctggaccagcgcgctctctggaaatagctccggccccggcccaggctcgtccccggccggcagcaccaagccttttgtgcacgccgtgcccccctctgaccccctgcgccaggccaaccgcctgccaatcaaggtgctgaagatgctgacggcacgaactggccacattttgcaccccgagtacctgcagcccctgccttccacgccggtcagccccatcgagctcgatgccaagaagagcccgctggcgctgttggcgcaaacatgttcgcagatcgggaagcccgacccctcgccctcctccaaactctcctcggttgcctccaacgggggcggcgcgggcggtgccggcggcggtgctgcgggcgacaaggacaccaaatcgggccccctgaagctgagcgacatcggcgtggaggacaagtcgagtttcaagccgtactccaaacccggctcggataagaaggagccgggaggcggcggtggaggcggtggcggtggcgggggcggcggcgggggtgtttcgtcggagaagtcgggattccgggtaccgagcgccacctgccagccattcacgcccaggacaggcagcccgagctccagcgcctcggccgaagggggacccacggggctggcacacggccggattagctgcggcggcgggattaatgtggatgtgaaccagcatccggatgggggcccgggaggcaaggctctgggctcggactgcggcggttcatcgggctccagctccggctccggccccagcgcgcccacctcctcctcagtgttgggctctgggctggtggctcccgtgtcaccctacaagccgggccagacagtgttccctctgcctcccgcgggtatgacctacccaggcagcctggccggggcctacgccggctacccgccccagttcctgccacacggcgtggcacttgaccccaccaagccgggcagcctggtgggggcgcagctggcggcggccgcggccgggtctctgggctgcagtaagccggccggctccagccctttggccggagcgtctccgccgtccgtgatgacagccagtttgtgccgggacccttactgcctcagctaccactgcgctagccacctggcaggggcggcggccgccagcgcttcttgcgcacatgatccggctgctgcggctgcggcgctgaagtccggatacccgctggtgtaccccacgcacccgctgcacggtgtgcactcctcgctaacggccgccgcggctgctggcgccacaccgccctccctggccggccaccccctctacccctacggctttatgctccctaacgacccactcccccacatctgcaactgggtgtcggccaacgggccgtgcgacaagcgcttcgccacgtccgaagagctgctgagccacttgcggacccatacggcatttcccgggacagacaaactgctgtcgggctaccccagctcgtcgtctctggccagcgctgccgcggccgccatggcttgccacatgcacatccccacctcgggcgcaccgggcagccctgggacgctggcgctgcgcagcccccaccacgcgctgggactcagcagccgctaccacccctactccaagagcccgcttcccacgcctggcgcccccgtgccggtgcccgccgccaccggaccgtactactccccctacgccctctacggacagagactgaccaccgcctcggcgctggggtatcagtga
Sequence Length
1830
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,924 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 503, mRNA
NCBI Official Synonym Full Names
zinc finger protein 503
NCBI Official Symbol
ZNF503
NCBI Official Synonym Symbols
Nlz2; NOLZ1; NOLZ-1
NCBI Protein Information
zinc finger protein 503
UniProt Protein Name
Zinc finger protein 503
Protein Family
UniProt Gene Name
ZNF503
UniProt Synonym Gene Names
NOLZ1
UniProt Entry Name
ZN503_HUMAN

Uniprot Description

ZNF503: May function as a transcriptional repressor. Belongs to the Elbow/Noc family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Motility/polarity/chemotaxis; C2H2-type zinc finger protein; Transcription regulation

Chromosomal Location of Human Ortholog: 10q22.2

Biological Process: negative regulation of cell proliferation

Similar Products

Product Notes

The ZNF503 znf503 (Catalog #AAA1274854) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagcacag cgccctcgct ttctgcccta agaagcagta agcacagcgg cggcggcggc ggcggcggcg gaggcggcgg tgcagaccct gcctggacca gcgcgctctc tggaaatagc tccggccccg gcccaggctc gtccccggcc ggcagcacca agccttttgt gcacgccgtg cccccctctg accccctgcg ccaggccaac cgcctgccaa tcaaggtgct gaagatgctg acggcacgaa ctggccacat tttgcacccc gagtacctgc agcccctgcc ttccacgccg gtcagcccca tcgagctcga tgccaagaag agcccgctgg cgctgttggc gcaaacatgt tcgcagatcg ggaagcccga cccctcgccc tcctccaaac tctcctcggt tgcctccaac gggggcggcg cgggcggtgc cggcggcggt gctgcgggcg acaaggacac caaatcgggc cccctgaagc tgagcgacat cggcgtggag gacaagtcga gtttcaagcc gtactccaaa cccggctcgg ataagaagga gccgggaggc ggcggtggag gcggtggcgg tggcgggggc ggcggcgggg gtgtttcgtc ggagaagtcg ggattccggg taccgagcgc cacctgccag ccattcacgc ccaggacagg cagcccgagc tccagcgcct cggccgaagg gggacccacg gggctggcac acggccggat tagctgcggc ggcgggatta atgtggatgt gaaccagcat ccggatgggg gcccgggagg caaggctctg ggctcggact gcggcggttc atcgggctcc agctccggct ccggccccag cgcgcccacc tcctcctcag tgttgggctc tgggctggtg gctcccgtgt caccctacaa gccgggccag acagtgttcc ctctgcctcc cgcgggtatg acctacccag gcagcctggc cggggcctac gccggctacc cgccccagtt cctgccacac ggcgtggcac ttgaccccac caagccgggc agcctggtgg gggcgcagct ggcggcggcc gcggccgggt ctctgggctg cagtaagccg gccggctcca gccctttggc cggagcgtct ccgccgtccg tgatgacagc cagtttgtgc cgggaccctt actgcctcag ctaccactgc gctagccacc tggcaggggc ggcggccgcc agcgcttctt gcgcacatga tccggctgct gcggctgcgg cgctgaagtc cggatacccg ctggtgtacc ccacgcaccc gctgcacggt gtgcactcct cgctaacggc cgccgcggct gctggcgcca caccgccctc cctggccggc caccccctct acccctacgg ctttatgctc cctaacgacc cactccccca catctgcaac tgggtgtcgg ccaacgggcc gtgcgacaag cgcttcgcca cgtccgaaga gctgctgagc cacttgcgga cccatacggc atttcccggg acagacaaac tgctgtcggg ctaccccagc tcgtcgtctc tggccagcgc tgccgcggcc gccatggctt gccacatgca catccccacc tcgggcgcac cgggcagccc tgggacgctg gcgctgcgca gcccccacca cgcgctggga ctcagcagcc gctaccaccc ctactccaag agcccgcttc ccacgcctgg cgcccccgtg ccggtgcccg ccgccaccgg accgtactac tccccctacg ccctctacgg acagagactg accaccgcct cggcgctggg gtatcagtga. It is sometimes possible for the material contained within the vial of "ZNF503, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.