ZNF385B cdna clone
ZNF385B cDNA Clone
Gene Names
ZNF385B; ZNF533
Synonyms
ZNF385B; ZNF385B cDNA Clone; ZNF385B cdna clone
Sequence
atgatgcagccttcactggatatcaaaccatttatgtcttttccagtggacagtagttctgctgttgggctctttccaaattttaacacaatggatcctgtgcaaaaagcggttattaaccatacatttggagtatccattcccccaaagaagaaacaagttatttcttgtaatgtctgtcagcttcgctttaactcagatagccaggccgaggcccactacaaaggaagtaaacatgccaagaaggtcaaagcactagacgcaacgaaaaataaacccaaaatggttccttccaaggacagcgcaaaggctaatcccagctgctccatcactccaatcacaggcaacaactctgacaaatcagaagataaagggaagttaaaagccagcagttccagtcagccatcaagctctgaaagtggctcatttctcctcaaatctggcacaacacccctgccacctggagcagccacttctccctccaagagcacaaatggagctcccggtactgttgttgaatcagaagaagaaaaagccaaaaaattactttattgttcactatgcaaagtggctgtgaactccctgtcacagctagaggcacacaacacaggatctaaacacaagaccatggttgaagctcgtaatggggctggtccaattaaatcctatcctagacctggatcaagattaaagatgcagaatggcagtaaggggtcaggactacagaacaagacatttcattgtgaaatctgtgatgttcatgttaattcagaaattcaactcaaacagcacatttctagccgaaggcataaagatcgagttgcagggaaaccactgaagccaaaatacagcccttacaacaaactccagcggagcccgagtattctagcagcaaaacttgcattccagaaagatatgatgaagcctttggccccagccttcctgtcctcacctctcgcagcggcggcagccgtgtcctcagcgctgtcactcccaccccggccctctgcctcgctcttccaggctccagccattcctccagctcttctgaggcctgggcatgggcccatccgcgccactcctgcctccatcctctttgctccgtactaa
Sequence Length
1110
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,476 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 385B, mRNA
NCBI Official Synonym Full Names
zinc finger protein 385B
NCBI Official Symbol
ZNF385B
NCBI Official Synonym Symbols
ZNF533
NCBI Protein Information
zinc finger protein 385B
UniProt Protein Name
Zinc finger protein 385B
Protein Family
UniProt Gene Name
ZNF385B
UniProt Synonym Gene Names
ZNF533
UniProt Entry Name
Z385B_HUMAN
Uniprot Description
ZNF385B: 5 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2q31.2-q31.3
Cellular Component: nucleus
Molecular Function: p53 binding; RNA binding
Research Articles on ZNF385B
Similar Products
Product Notes
The ZNF385B znf385b (Catalog #AAA1274186) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatgcagc cttcactgga tatcaaacca tttatgtctt ttccagtgga cagtagttct gctgttgggc tctttccaaa ttttaacaca atggatcctg tgcaaaaagc ggttattaac catacatttg gagtatccat tcccccaaag aagaaacaag ttatttcttg taatgtctgt cagcttcgct ttaactcaga tagccaggcc gaggcccact acaaaggaag taaacatgcc aagaaggtca aagcactaga cgcaacgaaa aataaaccca aaatggttcc ttccaaggac agcgcaaagg ctaatcccag ctgctccatc actccaatca caggcaacaa ctctgacaaa tcagaagata aagggaagtt aaaagccagc agttccagtc agccatcaag ctctgaaagt ggctcatttc tcctcaaatc tggcacaaca cccctgccac ctggagcagc cacttctccc tccaagagca caaatggagc tcccggtact gttgttgaat cagaagaaga aaaagccaaa aaattacttt attgttcact atgcaaagtg gctgtgaact ccctgtcaca gctagaggca cacaacacag gatctaaaca caagaccatg gttgaagctc gtaatggggc tggtccaatt aaatcctatc ctagacctgg atcaagatta aagatgcaga atggcagtaa ggggtcagga ctacagaaca agacatttca ttgtgaaatc tgtgatgttc atgttaattc agaaattcaa ctcaaacagc acatttctag ccgaaggcat aaagatcgag ttgcagggaa accactgaag ccaaaataca gcccttacaa caaactccag cggagcccga gtattctagc agcaaaactt gcattccaga aagatatgat gaagcctttg gccccagcct tcctgtcctc acctctcgca gcggcggcag ccgtgtcctc agcgctgtca ctcccacccc ggccctctgc ctcgctcttc caggctccag ccattcctcc agctcttctg aggcctgggc atgggcccat ccgcgccact cctgcctcca tcctctttgc tccgtactaa. It is sometimes possible for the material contained within the vial of "ZNF385B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
