ZNF25 cdna clone
ZNF25 cDNA Clone
Gene Names
ZNF25; Zfp9; KOX19
Synonyms
ZNF25; ZNF25 cDNA Clone; ZNF25 cdna clone
Sequence
atgctggaaaactatagtcaccttgtctcagtgggttaccatgtgaataagccaaatgcagtcttcaagttgaagcaaggaaaagagccatggatattagaagtagaatttccacatcggggcttccctgaagacctatggagcattcatgatctagaagcaagataccaggaaagccaagctggaaattcaaggaatggagaactcacaaaacatcagaaaactcataccacagagaaagcctgtgaatgtaaggaatgtgggaagttcttctgccagaagtctgccctcatagtacatcagcatactcactcaaagggcaaatcctatgactgtgataaatgtgggaaatctttctctaaaaatgaagacctcataagacatcagaaaattcacacgagagataaaacctatgagtgtaaagaatgtaagaaaatattttaccacctatcatctctcagtagacatctgagaacccatgcaggagagaaaccctatgaatgtaatcagtgtgaaaaatccttctaccagaaaccacatctcacagaacatcagaaaacacacacaggggagaaaccttttgaatgtactgaatgtgggaagttcttctatgtgaaggcatacctcatggtacatcagaaaacacacacaggggagaaaccctatgagtgtaaggagtgtgggaaagccttttcccagaagtcacacctcacagtacatcagagaatgcacacaggggagaaaccctataaatgtaaggaatgtgggaaattcttctctaggaattcacacctcaaaactcatcagagaagtcacacaggagagaaaccctatgaatgtaaggaatgtaggaaatgcttctaccagaagtcagccctcacagtacatcagcgaactcacacaggggagaaaccctttgaatgtaataaatgtgggaaaacattttactataaatcagacctcactaaacatcagagaaaacacacaggggagaagccctatgaatgcacagaatgtggcaaatcttttgctgtgaattcagtcctcagattacatcaaaggactcacacaggagagaagccctatgcatgcaaggaatgtgggaagtccttttctcagaagtcacattttattatacatcagagaaaacacacaggggagaagccctatgagtgtcaggagtgtggggaaacctttatccagaagtcacaactcactgcacatcagaagacacacacaaagaagaggaaggctgagaagtaa
Sequence Length
1263
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
42,625 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 25, mRNA
NCBI Official Synonym Full Names
zinc finger protein 25
NCBI Official Symbol
ZNF25
NCBI Official Synonym Symbols
Zfp9; KOX19
NCBI Protein Information
zinc finger protein 25
UniProt Protein Name
Zinc finger protein 25
Protein Family
UniProt Gene Name
ZNF25
UniProt Synonym Gene Names
KOX19
UniProt Entry Name
ZNF25_HUMAN
Uniprot Description
ZNF25: May be involved in transcriptional regulation. Belongs to the krueppel C2H2-type zinc-finger protein family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 10p11.1
Research Articles on ZNF25
Similar Products
Product Notes
The ZNF25 znf25 (Catalog #AAA1265913) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggaaa actatagtca ccttgtctca gtgggttacc atgtgaataa gccaaatgca gtcttcaagt tgaagcaagg aaaagagcca tggatattag aagtagaatt tccacatcgg ggcttccctg aagacctatg gagcattcat gatctagaag caagatacca ggaaagccaa gctggaaatt caaggaatgg agaactcaca aaacatcaga aaactcatac cacagagaaa gcctgtgaat gtaaggaatg tgggaagttc ttctgccaga agtctgccct catagtacat cagcatactc actcaaaggg caaatcctat gactgtgata aatgtgggaa atctttctct aaaaatgaag acctcataag acatcagaaa attcacacga gagataaaac ctatgagtgt aaagaatgta agaaaatatt ttaccaccta tcatctctca gtagacatct gagaacccat gcaggagaga aaccctatga atgtaatcag tgtgaaaaat ccttctacca gaaaccacat ctcacagaac atcagaaaac acacacaggg gagaaacctt ttgaatgtac tgaatgtggg aagttcttct atgtgaaggc atacctcatg gtacatcaga aaacacacac aggggagaaa ccctatgagt gtaaggagtg tgggaaagcc ttttcccaga agtcacacct cacagtacat cagagaatgc acacagggga gaaaccctat aaatgtaagg aatgtgggaa attcttctct aggaattcac acctcaaaac tcatcagaga agtcacacag gagagaaacc ctatgaatgt aaggaatgta ggaaatgctt ctaccagaag tcagccctca cagtacatca gcgaactcac acaggggaga aaccctttga atgtaataaa tgtgggaaaa cattttacta taaatcagac ctcactaaac atcagagaaa acacacaggg gagaagccct atgaatgcac agaatgtggc aaatcttttg ctgtgaattc agtcctcaga ttacatcaaa ggactcacac aggagagaag ccctatgcat gcaaggaatg tgggaagtcc ttttctcaga agtcacattt tattatacat cagagaaaac acacagggga gaagccctat gagtgtcagg agtgtgggga aacctttatc cagaagtcac aactcactgc acatcagaag acacacacaa agaagaggaa ggctgagaag taa. It is sometimes possible for the material contained within the vial of "ZNF25, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
