ZNF207 cdna clone
ZNF207 cDNA Clone
Gene Names
ZNF207; BuGZ; hBuGZ
Synonyms
ZNF207; ZNF207 cDNA Clone; ZNF207 cdna clone
Sequence
atgggtcgcaagaagaagaagcagctgaagccgtggtgctggtattgtaatagagattttgatgatgagaagatccttattcagcaccaaaaagcaaagcattttaaatgccatatatgtcacaagaaattgtatacaggactgccaccagtaccaggagcaccaggaatgcctccaggcatacctccattaatgccaggtgttcctcctctgatgccaggaatgccaccagttatgccaggcatgccacctggattgcatcatcagagaaaatacacccagtcattttgcggtgaaaacataatgatgccaatgggtggaatgatgccacctggaccaggaataccacctctgatgcctggaatgccaccaggtatgcccccacctgttccacgtcctggaattcctccaatgactcaagcacaggctgtttcagcgccaggtattcttaatagaccacctgcaccaacagcaactgtacctgccccacagcctccagttactaagcctcttttccccagtgctggacagatggggacacctgtcacaagctcaagtacagcttcatccaattcagaaagtctgtctgcatcttctaaagctctgtttcctagcacagcacaagctcaggcagctgtccaaggacctgttggtacagatttcaaacccttaaatagtacccctgcaacaactacagaacccccaaagcctacattccctgcttatacacagtctacagcttcaacaactagtacaacaaatagtactgcagctaaaccagcggcttcaataacaagtaagcctgctacacttacaacaactagtgcaaccagtaagttgatccatccagatgaggatatatccctggaagagagaagggcacagttacctaagtatcaacgtaatcttcctcggccaggacaggcccccatcggtaatccaccagttggaccaattggaggtatgatgccaccacagccaggcatcccacagcaacaaggaatgagacccccaatgccacctcatggtcagtatggtggtcatcatcaaggcatgccaggataccttcctggtgctatgcccccgtatgggcagggaccgccaatggtgcccccttaccagggtgggcctcctcgacctccgatgggaatgagacctcctgtaatgtcgcaaggtggccgttactga
Sequence Length
1188
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
52,694 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 207, mRNA
NCBI Official Synonym Full Names
zinc finger protein 207
NCBI Official Symbol
ZNF207
NCBI Official Synonym Symbols
BuGZ; hBuGZ
NCBI Protein Information
BUB3-interacting and GLEBS motif-containing protein ZNF207
UniProt Protein Name
BUB3-interacting and GLEBS motif-containing protein ZNF207
Protein Family
UniProt Gene Name
ZNF207
UniProt Synonym Gene Names
hBuGZ
UniProt Entry Name
ZN207_HUMAN
Uniprot Description
ZNF207: 3 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription factor; C2H2-type zinc finger protein; Spliceosome
Chromosomal Location of Human Ortholog: 17q11.2
Cellular Component: kinetochore; nucleolus; nucleus
Molecular Function: microtubule binding; protein binding
Biological Process: attachment of spindle microtubules to kinetochore; microtubule bundle formation; microtubule polymerization; mitotic cell cycle spindle assembly checkpoint; mitotic sister chromatid segregation; protein stabilization; regulation of chromosome segregation
Research Articles on ZNF207
Similar Products
Product Notes
The ZNF207 znf207 (Catalog #AAA1268587) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtcgca agaagaagaa gcagctgaag ccgtggtgct ggtattgtaa tagagatttt gatgatgaga agatccttat tcagcaccaa aaagcaaagc attttaaatg ccatatatgt cacaagaaat tgtatacagg actgccacca gtaccaggag caccaggaat gcctccaggc atacctccat taatgccagg tgttcctcct ctgatgccag gaatgccacc agttatgcca ggcatgccac ctggattgca tcatcagaga aaatacaccc agtcattttg cggtgaaaac ataatgatgc caatgggtgg aatgatgcca cctggaccag gaataccacc tctgatgcct ggaatgccac caggtatgcc cccacctgtt ccacgtcctg gaattcctcc aatgactcaa gcacaggctg tttcagcgcc aggtattctt aatagaccac ctgcaccaac agcaactgta cctgccccac agcctccagt tactaagcct cttttcccca gtgctggaca gatggggaca cctgtcacaa gctcaagtac agcttcatcc aattcagaaa gtctgtctgc atcttctaaa gctctgtttc ctagcacagc acaagctcag gcagctgtcc aaggacctgt tggtacagat ttcaaaccct taaatagtac ccctgcaaca actacagaac ccccaaagcc tacattccct gcttatacac agtctacagc ttcaacaact agtacaacaa atagtactgc agctaaacca gcggcttcaa taacaagtaa gcctgctaca cttacaacaa ctagtgcaac cagtaagttg atccatccag atgaggatat atccctggaa gagagaaggg cacagttacc taagtatcaa cgtaatcttc ctcggccagg acaggccccc atcggtaatc caccagttgg accaattgga ggtatgatgc caccacagcc aggcatccca cagcaacaag gaatgagacc cccaatgcca cctcatggtc agtatggtgg tcatcatcaa ggcatgccag gataccttcc tggtgctatg cccccgtatg ggcagggacc gccaatggtg cccccttacc agggtgggcc tcctcgacct ccgatgggaa tgagacctcc tgtaatgtcg caaggtggcc gttactga. It is sometimes possible for the material contained within the vial of "ZNF207, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
