ZNF202 cdna clone
ZNF202 cDNA Clone
Gene Names
ZNF202; ZSCAN42; ZKSCAN10
Synonyms
ZNF202; ZNF202 cDNA Clone; ZNF202 cdna clone
Sequence
atggctacagccgtggaaccagaggaccaggatctttgggaagaagagggaattctgatggtgaaactggaagatgatttcacctgtcggccagagtctgtcttacagagggatgacccggtgctggaaacctcccaccagaacttccgacgcttccgctaccaggaggcagcaagccctagagaagctctcatcagactccgagaactttgtcaccagtggctgagaccagagaggcggacaaaggagcagatcctagagctgcttgtgctggaacaatttcttaccgtcctacctggagaactacagagctgggtgcggggccaacggccagaaagtggcgaggaggcagtgacgctggtggagggtttgcagaaacaacccaggagaccaaggcggtgggtgactgtccatgttcacggccaggaagtcctgtcagaggagacggtgcatttaggagcggagcctgagtcacctaatgagctgcaggatcctgtgcaaagctcgacccccgagcagtctcctgaggaaaccacacagagcccagatctgggggcaccggcagagcagcgtccacaccaggaagaggagctccagaccctgcaggagagcgaggtcccagtgcccgaggacccagaccttcctgcagagaggagctctggagactcagagatggttgctcttcttactgctctgtcacagggactggtaacgttcaaggatgtggccgtatgcttttcccaggaccagtggagtgatctggacccaacacagaaagagttctatggagaatatgtcttggaagaagactgtggaattgttgtctctctgtcatttccaatccccagacctgatgagatctcccaggttagagaggaagagccttgggtcccagatatccaagagcctcaggagactcaagagccagaaatcctgagttttacctacacaggagataggagtaaagatgaggaagagtgtctggagcaggaagatctgagtttggaggatatacacaggcctgttttgggagaaccagaaattcaccagactccagattgggaaatagtctttgaggacaatccaggtagacttaatgaaagaagatttggtactaatatttctcaagtgaatagttttgtgaaccttcgggaaactacacccgtccaccccctgttagggaggcatcatgactgttctgtgtgtggaaagagcttcacttgtaactcccaccttgttagacacctgaggactcacacaggagagaaaccctataaatgtatggaatgtggaaaaagttacacacgaagctcacatcttgccaggcaccaaaaggttcacaagatgaacgcgccttacaaatatcccctaaaccggaagaatttggaagagacctcccctgtgacacaggctgagagaactccatcagtggagaaaccctatagatgtgatgattgcggaaagcacttccgctggacttcagaccttgtcagacatcagaggacacatactggagaaaaacccttcttttgtactatttgtggcaaaagcttcagccagaaatctgtgttaacaacacaccaaagaatccacctgggaggcaaaccctacttgtgtggagagtgtggtgaggacttcagtgaacacaggcggtacctggcgcaccggaagacgcacgctgctgaggaactctacctctgcagcgagtgcgggcgctgcttcacccacagcgcagcgttcgccaagcacttgagaggacacgcctcagtgaggccctgccgatgcaacgaatgtgggaagagcttcagtcgcagggaccacctcgtcaggcatcagagaacacacactggggagaaaccattcacgtgccctacctgtggaaaaagcttcagcagaggatatcacttaattaggcatcagaggacccactcagaaaagacctcctag
Sequence Length
1947
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,952 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 202, mRNA
NCBI Official Synonym Full Names
zinc finger protein 202
NCBI Official Symbol
ZNF202
NCBI Official Synonym Symbols
ZSCAN42; ZKSCAN10
NCBI Protein Information
zinc finger protein 202
UniProt Protein Name
Zinc finger protein 202
Protein Family
UniProt Gene Name
ZNF202
UniProt Synonym Gene Names
ZKSCAN10
UniProt Entry Name
ZN202_HUMAN
Uniprot Description
ZNF202: Transcriptional repressor that binds to elements found predominantly in genes that participate in lipid metabolism. Among its targets are structural components of lipoprotein particles (apolipoproteins AIV, CIII, and E), enzymes involved in lipid processing (lipoprotein lipase, lecithin cholesteryl ester transferase), transporters involved in lipid homeostasis (ABCA1, ABCG1), and several genes involved in processes related to energy metabolism and vascular disease. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Transcription factor; C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 11q24
Cellular Component: mitochondrion; nucleoplasm; nucleus
Molecular Function: protein binding; transcription factor activity
Biological Process: lipid metabolic process; negative regulation of transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter
Research Articles on ZNF202
Similar Products
Product Notes
The ZNF202 znf202 (Catalog #AAA1272269) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctacag ccgtggaacc agaggaccag gatctttggg aagaagaggg aattctgatg gtgaaactgg aagatgattt cacctgtcgg ccagagtctg tcttacagag ggatgacccg gtgctggaaa cctcccacca gaacttccga cgcttccgct accaggaggc agcaagccct agagaagctc tcatcagact ccgagaactt tgtcaccagt ggctgagacc agagaggcgg acaaaggagc agatcctaga gctgcttgtg ctggaacaat ttcttaccgt cctacctgga gaactacaga gctgggtgcg gggccaacgg ccagaaagtg gcgaggaggc agtgacgctg gtggagggtt tgcagaaaca acccaggaga ccaaggcggt gggtgactgt ccatgttcac ggccaggaag tcctgtcaga ggagacggtg catttaggag cggagcctga gtcacctaat gagctgcagg atcctgtgca aagctcgacc cccgagcagt ctcctgagga aaccacacag agcccagatc tgggggcacc ggcagagcag cgtccacacc aggaagagga gctccagacc ctgcaggaga gcgaggtccc agtgcccgag gacccagacc ttcctgcaga gaggagctct ggagactcag agatggttgc tcttcttact gctctgtcac agggactggt aacgttcaag gatgtggccg tatgcttttc ccaggaccag tggagtgatc tggacccaac acagaaagag ttctatggag aatatgtctt ggaagaagac tgtggaattg ttgtctctct gtcatttcca atccccagac ctgatgagat ctcccaggtt agagaggaag agccttgggt cccagatatc caagagcctc aggagactca agagccagaa atcctgagtt ttacctacac aggagatagg agtaaagatg aggaagagtg tctggagcag gaagatctga gtttggagga tatacacagg cctgttttgg gagaaccaga aattcaccag actccagatt gggaaatagt ctttgaggac aatccaggta gacttaatga aagaagattt ggtactaata tttctcaagt gaatagtttt gtgaaccttc gggaaactac acccgtccac cccctgttag ggaggcatca tgactgttct gtgtgtggaa agagcttcac ttgtaactcc caccttgtta gacacctgag gactcacaca ggagagaaac cctataaatg tatggaatgt ggaaaaagtt acacacgaag ctcacatctt gccaggcacc aaaaggttca caagatgaac gcgccttaca aatatcccct aaaccggaag aatttggaag agacctcccc tgtgacacag gctgagagaa ctccatcagt ggagaaaccc tatagatgtg atgattgcgg aaagcacttc cgctggactt cagaccttgt cagacatcag aggacacata ctggagaaaa acccttcttt tgtactattt gtggcaaaag cttcagccag aaatctgtgt taacaacaca ccaaagaatc cacctgggag gcaaacccta cttgtgtgga gagtgtggtg aggacttcag tgaacacagg cggtacctgg cgcaccggaa gacgcacgct gctgaggaac tctacctctg cagcgagtgc gggcgctgct tcacccacag cgcagcgttc gccaagcact tgagaggaca cgcctcagtg aggccctgcc gatgcaacga atgtgggaag agcttcagtc gcagggacca cctcgtcagg catcagagaa cacacactgg ggagaaacca ttcacgtgcc ctacctgtgg aaaaagcttc agcagaggat atcacttaat taggcatcag aggacccact cagaaaagac ctcctag. It is sometimes possible for the material contained within the vial of "ZNF202, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
