Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZNF136 cdna clone

ZNF136 cDNA Clone

Gene Names
ZNF136; pHZ-20
Synonyms
ZNF136; ZNF136 cDNA Clone; ZNF136 cdna clone
Ordering
For Research Use Only!
Sequence
atggactcggtggcttttgaggatgtagatgtgaacttcacccaggaggagtgggctttgctagatccttcccagaagaatctctacagagatgtgatgtgggaaaccatgaggaatctggcctctatagggaaaaaatggaaggaccagaacattaaagatcactacaaacaccgagggagaaatctaagaagtcatatgttagaaagactctatcaaactaaggatggtagtcagcgtggaggaatttttagccagtttgcaaatcagaatctgagcaagaaaatccctggagtgaaactctgtgaaagcattgtatatggagaagtcagcatgggtcagtcatcccttaatagacacatcaaagatcacagtggacatgaaccaaaggaatatcaggaatatggagagaagccagatacacgtaaccagtgttggaaacccttcagttctcaccactcctttcgaacacatgagataattcacactggagagaaactctatgattgtaaggaatgtggaaaaaccttcttttctctcaaaagaattagaagacacatcatcacacacagtggatatacaccatataaatgtaaggtgtgtgggaaagcttttgattatcccagtagatttcgaacacatgaaagaagtcacactggagagaaaccctatgaatgtcaggaatgtggaaaagccttcacttgtatcacaagtgttcgaagacacatgataaagcacactggagatggaccttataaatgtaaggtatgtgggaaaccctttcattctctgagttcatttcaagtgcatgaaagaattcacactggagaaaaaccctttaaatgtaagcaatgtggtaaagccttcagttgttccccaaccttacgaatacatgaaagaacccatactggagagaaaccttatgaatgcaagcagtgtgggaaggccttcagttatctcccctcccttcgactacatgaaagaattcacactggtgagaaacccttcgtatgtaaacaatgtggtaaagcctttagatctgccagtacctttcaaatacatgaaaggactcacactggagaaaaaccttatgaatgtaaggaatgtggggaagcattcagttgtatcccaagtatgcgaagacacatgataaaacatactggagaaggaccttataaatgtaaggtatgtgggaaaccctttcattctctgagtccatttcgaatacatgaaagaactcacactggagagaaaccttatgtatgtaaacattgtggtaaagctttcgtttcttcaacatcaattcgaatacatgaaagaactcatactggagagaaaccctatgagtgtaagcaatgtgggaaagccttcagttatctcaactcctttcgaacacatgaaatgattcacactggtgagaaaccctttgaatgtaagcgatgtggtaaagcctttagatcttctagttcctttcgactacatgaaaggactcacactggacagaaaccctatcattgcaaggaatgtgggaaagcctattcttgccgtgccagctttcagagacacatgttaacacatgctgaagatggaccaccttataaatgcatgtgggaaagcctttaa
Sequence Length
1623
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,784 Da
NCBI Official Full Name
Homo sapiens zinc finger protein 136, mRNA
NCBI Official Synonym Full Names
zinc finger protein 136
NCBI Official Symbol
ZNF136
NCBI Official Synonym Symbols
pHZ-20
NCBI Protein Information
zinc finger protein 136
UniProt Protein Name
Zinc finger protein 136
Protein Family
UniProt Gene Name
ZNF136
UniProt Entry Name
ZN136_HUMAN

Uniprot Description

ZNF136: May be involved in transcriptional regulation as a weak repressor when alone, or a potent one when fused with a heterologous protein containing a KRAB B-domain. Belongs to the krueppel C2H2-type zinc-finger protein family.

Protein type: C2H2-type zinc finger protein; DNA-binding

Chromosomal Location of Human Ortholog: 19p13.2

Molecular Function: protein binding; transcription corepressor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; transcription from RNA polymerase II promoter

Research Articles on ZNF136

Similar Products

Product Notes

The ZNF136 znf136 (Catalog #AAA1275201) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactcgg tggcttttga ggatgtagat gtgaacttca cccaggagga gtgggctttg ctagatcctt cccagaagaa tctctacaga gatgtgatgt gggaaaccat gaggaatctg gcctctatag ggaaaaaatg gaaggaccag aacattaaag atcactacaa acaccgaggg agaaatctaa gaagtcatat gttagaaaga ctctatcaaa ctaaggatgg tagtcagcgt ggaggaattt ttagccagtt tgcaaatcag aatctgagca agaaaatccc tggagtgaaa ctctgtgaaa gcattgtata tggagaagtc agcatgggtc agtcatccct taatagacac atcaaagatc acagtggaca tgaaccaaag gaatatcagg aatatggaga gaagccagat acacgtaacc agtgttggaa acccttcagt tctcaccact cctttcgaac acatgagata attcacactg gagagaaact ctatgattgt aaggaatgtg gaaaaacctt cttttctctc aaaagaatta gaagacacat catcacacac agtggatata caccatataa atgtaaggtg tgtgggaaag cttttgatta tcccagtaga tttcgaacac atgaaagaag tcacactgga gagaaaccct atgaatgtca ggaatgtgga aaagccttca cttgtatcac aagtgttcga agacacatga taaagcacac tggagatgga ccttataaat gtaaggtatg tgggaaaccc tttcattctc tgagttcatt tcaagtgcat gaaagaattc acactggaga aaaacccttt aaatgtaagc aatgtggtaa agccttcagt tgttccccaa ccttacgaat acatgaaaga acccatactg gagagaaacc ttatgaatgc aagcagtgtg ggaaggcctt cagttatctc ccctcccttc gactacatga aagaattcac actggtgaga aacccttcgt atgtaaacaa tgtggtaaag cctttagatc tgccagtacc tttcaaatac atgaaaggac tcacactgga gaaaaacctt atgaatgtaa ggaatgtggg gaagcattca gttgtatccc aagtatgcga agacacatga taaaacatac tggagaagga ccttataaat gtaaggtatg tgggaaaccc tttcattctc tgagtccatt tcgaatacat gaaagaactc acactggaga gaaaccttat gtatgtaaac attgtggtaa agctttcgtt tcttcaacat caattcgaat acatgaaaga actcatactg gagagaaacc ctatgagtgt aagcaatgtg ggaaagcctt cagttatctc aactcctttc gaacacatga aatgattcac actggtgaga aaccctttga atgtaagcga tgtggtaaag cctttagatc ttctagttcc tttcgactac atgaaaggac tcacactgga cagaaaccct atcattgcaa ggaatgtggg aaagcctatt cttgccgtgc cagctttcag agacacatgt taacacatgc tgaagatgga ccaccttata aatgcatgtg ggaaagcctt taa. It is sometimes possible for the material contained within the vial of "ZNF136, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.