Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZHX2 cdna clone

ZHX2 cDNA Clone

Gene Names
ZHX2; RAF; AFR1
Synonyms
ZHX2; ZHX2 cDNA Clone; ZHX2 cdna clone
Ordering
For Research Use Only!
Sequence
atggctagcaaacgaaaatctacaactccatgcatggttcggacatcacaagtagtagaacaagatgtgcccgaggaagtagacagggccaaagagaaaggaatcggcacaccacagcctgacgtggccaaggacagttgggcagcagaacttgaaaactcttccaaagaaaacgaagtgatagaggtgaaatctatgggggaaagccagtccaaaaaactccaaggtggttatgagtgcaaatactgcccctactccacgcaaaacctgaacgagttcacggagcatgtcgacatgcagcatcccaacgtgattctcaaccccctctacgtgtgtgcagaatgtaacttcacaaccaaaaagtacgactccctatccgaccacaactccaagttccatcccggggaggccaacttcaagctgaagttaattaaacgcaataatcaaactgtcttggaacagtccatcgaaaccaccaaccatgtcgtgtccatcaccaccagtggccctggaactggtgacagtgattctgggatctcggtgagtaaaacccccatcatgaagcctggaaaaccaaaagcggatgccaagaaggtgcccaagaagcccgaggagatcacccccgagaaccacgtggaagggaccgcccgcctggtgacagacacagctgagatcctctcgagactcggcggggtggagctcctccaagacacattaggacacgtcatgccttctgtacagctgccaccaaatatcaaccttgtgcccaaggtccctgtcccactaaatactaccaaatacaactctgccctggatacaaatgccacgatgatcaactctttcaacaagtttccttacccgacccaggctgagttgtcctggctgacagctgcctccaaacacccagaggagcacatcagaatctggtttgccacccagcgcttaaagcatggcatcagctggtccccagaagaggtggaggaggcccggaagaagatgttcaacggcaccatccagtcagtacccccgaccatcactgtgctgcccgcccagttggcccccacaaaggtgacgcagcccatcctccagacggctctaccgtgccagatcctcggccagactagcctggtgctgactcaggtgaccagcgggtcaacaaccgtctcttgctcccccatcacacttgccgtggcaggagtcaccaaccatggccagaagagacccttggtgactccccaagctgcccccgaacccaagcgtccacacatcgctcaggtgccagagcccccacccaaggtggccaaccccccgctcacaccagccagtgaccgcaagaagacaaaggagcagatagcacatctcaaggccagctttctccagagccagttccctgacgatgccgaggtttaccggctcatcgaggtgactggccttgccaggagcgagatcaagaagtggttcagtgaccaccgatatcggtgtcaaaggggcatcgtccacatcaccagcgaatcccttgccaaagaccagttggccatcgcggcctcccgacacggtcgcacgtatcatgcgtacccagactttgccccccagaagttcaaagagaaaacacagggtcaggttaaaatcttggaagacagctttttgaaaagttcttttcctacccaagcagaactggatcggctaagggtggagaccaagctgagcaggagagagatcgactcctggttctcggagaggcggaagcttcgagacagcatggaacaagctgtcttggattccatggggtctggcaaaaaaggccaagatgtgggagcccccaatggtgctctgtctcgactcgaccagctctccggtgcccagttaacaagttctctgcccagcccttcgccagcaattgcaaaaagtcaagaacaggttcatctcctgaggagcacgtttgcaagaacccagtggcctactccccaggagtacgaccagttagcggccaagactggcctggtccgaactgagattgtgcgttggttcaaggagaacagatgcttgctgaaaacgggaaccgtgaagtggatggagcagtaccagcaccagcccatggcagatgatcacggctacgatgccgtagcaaggaaagcaacaaaacccatggccgagagcccaaagaacgggggtgatgtggttccacaatattacaaggaccccaaaaagctctgcgaagaggacttggagaagttggtgaccagggtaaaagtaggcagcgagccagcaaaagactgtttgccagcaaagccctcagaggccacctcagaccggtcagagggcagcagccgggacggccagggtagcgacgagaacgaggagtcgagcgttgtggattacgtggaggtgacggtcggggaggaggatgcgatctcagatagatcagatagctggagtcaggctgcggcagaaggtgtgtcggaactggctgaatcagactccgactgcgtccctgcagaggctggccaggcctag
Sequence Length
2514
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
92,307 Da
NCBI Official Full Name
Homo sapiens zinc fingers and homeoboxes 2, mRNA
NCBI Official Synonym Full Names
zinc fingers and homeoboxes 2
NCBI Official Symbol
ZHX2
NCBI Official Synonym Symbols
RAF; AFR1
NCBI Protein Information
zinc fingers and homeoboxes protein 2
UniProt Protein Name
Zinc fingers and homeoboxes protein 2
UniProt Gene Name
ZHX2
UniProt Synonym Gene Names
AFR1; KIAA0854; RAF; AFP regulator 1
UniProt Entry Name
ZHX2_HUMAN

NCBI Description

The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]

Uniprot Description

ZHX2: Acts as a transcriptional repressor. Represses the promoter activity of the CDC25C gene stimulated by NFYA. Belongs to the ZHX family.

Protein type: C2H2-type zinc finger protein; Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: 8q24.13

Cellular Component: cytoplasm; nucleoplasm; nucleus; plasma membrane

Molecular Function: identical protein binding; protein binding; protein heterodimerization activity; protein homodimerization activity; transcription corepressor activity; transcription factor activity

Biological Process: negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent

Research Articles on ZHX2

Similar Products

Product Notes

The ZHX2 zhx2 (Catalog #AAA1276054) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctagca aacgaaaatc tacaactcca tgcatggttc ggacatcaca agtagtagaa caagatgtgc ccgaggaagt agacagggcc aaagagaaag gaatcggcac accacagcct gacgtggcca aggacagttg ggcagcagaa cttgaaaact cttccaaaga aaacgaagtg atagaggtga aatctatggg ggaaagccag tccaaaaaac tccaaggtgg ttatgagtgc aaatactgcc cctactccac gcaaaacctg aacgagttca cggagcatgt cgacatgcag catcccaacg tgattctcaa ccccctctac gtgtgtgcag aatgtaactt cacaaccaaa aagtacgact ccctatccga ccacaactcc aagttccatc ccggggaggc caacttcaag ctgaagttaa ttaaacgcaa taatcaaact gtcttggaac agtccatcga aaccaccaac catgtcgtgt ccatcaccac cagtggccct ggaactggtg acagtgattc tgggatctcg gtgagtaaaa cccccatcat gaagcctgga aaaccaaaag cggatgccaa gaaggtgccc aagaagcccg aggagatcac ccccgagaac cacgtggaag ggaccgcccg cctggtgaca gacacagctg agatcctctc gagactcggc ggggtggagc tcctccaaga cacattagga cacgtcatgc cttctgtaca gctgccacca aatatcaacc ttgtgcccaa ggtccctgtc ccactaaata ctaccaaata caactctgcc ctggatacaa atgccacgat gatcaactct ttcaacaagt ttccttaccc gacccaggct gagttgtcct ggctgacagc tgcctccaaa cacccagagg agcacatcag aatctggttt gccacccagc gcttaaagca tggcatcagc tggtccccag aagaggtgga ggaggcccgg aagaagatgt tcaacggcac catccagtca gtacccccga ccatcactgt gctgcccgcc cagttggccc ccacaaaggt gacgcagccc atcctccaga cggctctacc gtgccagatc ctcggccaga ctagcctggt gctgactcag gtgaccagcg ggtcaacaac cgtctcttgc tcccccatca cacttgccgt ggcaggagtc accaaccatg gccagaagag acccttggtg actccccaag ctgcccccga acccaagcgt ccacacatcg ctcaggtgcc agagccccca cccaaggtgg ccaacccccc gctcacacca gccagtgacc gcaagaagac aaaggagcag atagcacatc tcaaggccag ctttctccag agccagttcc ctgacgatgc cgaggtttac cggctcatcg aggtgactgg ccttgccagg agcgagatca agaagtggtt cagtgaccac cgatatcggt gtcaaagggg catcgtccac atcaccagcg aatcccttgc caaagaccag ttggccatcg cggcctcccg acacggtcgc acgtatcatg cgtacccaga ctttgccccc cagaagttca aagagaaaac acagggtcag gttaaaatct tggaagacag ctttttgaaa agttcttttc ctacccaagc agaactggat cggctaaggg tggagaccaa gctgagcagg agagagatcg actcctggtt ctcggagagg cggaagcttc gagacagcat ggaacaagct gtcttggatt ccatggggtc tggcaaaaaa ggccaagatg tgggagcccc caatggtgct ctgtctcgac tcgaccagct ctccggtgcc cagttaacaa gttctctgcc cagcccttcg ccagcaattg caaaaagtca agaacaggtt catctcctga ggagcacgtt tgcaagaacc cagtggccta ctccccagga gtacgaccag ttagcggcca agactggcct ggtccgaact gagattgtgc gttggttcaa ggagaacaga tgcttgctga aaacgggaac cgtgaagtgg atggagcagt accagcacca gcccatggca gatgatcacg gctacgatgc cgtagcaagg aaagcaacaa aacccatggc cgagagccca aagaacgggg gtgatgtggt tccacaatat tacaaggacc ccaaaaagct ctgcgaagag gacttggaga agttggtgac cagggtaaaa gtaggcagcg agccagcaaa agactgtttg ccagcaaagc cctcagaggc cacctcagac cggtcagagg gcagcagccg ggacggccag ggtagcgacg agaacgagga gtcgagcgtt gtggattacg tggaggtgac ggtcggggag gaggatgcga tctcagatag atcagatagc tggagtcagg ctgcggcaga aggtgtgtcg gaactggctg aatcagactc cgactgcgtc cctgcagagg ctggccaggc ctag. It is sometimes possible for the material contained within the vial of "ZHX2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.