ZFYVE21 cdna clone
ZFYVE21 cDNA Clone
Gene Names
ZFYVE21; ZF21; HCVP7TP1
Synonyms
ZFYVE21; ZFYVE21 cDNA Clone; ZFYVE21 cdna clone
Sequence
atgtcctccgaggtgtccgcgcgccgcgacgccaagaagctggtgcgctccccgagcggcctgcgcatggtgcccgaacaccgcgccttcggaagcccgttcggcctggaggagccgcagtgggtcccggacaaggagtgtcggagatgtatgcagtgtgacgccaagtttgactttctcaccagaaagcaccactgtcgccgctgcgggaagtgcttctgcgacaggtgctgcagccagaaggtgccgctgcggcgcatgtgctttgtggaccccgtgcggcagtgcgcggagtgcgccctggtgtccctcaaggaggcggagttctacgacaagcagctcaaagtgctcctgagcggagccaccttcctcgtcacgtttggaaactcagagaaacctgaaactatgacttgtcgtctttccaataaccagagatacttgtttctggatggagacagccactatgaaatcgaaattgtacacatttccaccgtgcagatcctcacagaaggcttccctcctggaggaggcaacgcacgggccacaggcatgttcctgcagtatacagtgccggggacggagggtgtgacccagctgaagctgacagtggtggaggacgtgactgtgggcaggaggcaggcggtggcgtggctagtggccatgcacaaggctgccaagctcctctatgaatctcgggaccagtaa
Sequence Length
705
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
28,477 Da
NCBI Official Full Name
Homo sapiens zinc finger, FYVE domain containing 21, mRNA
NCBI Official Synonym Full Names
zinc finger FYVE-type containing 21
NCBI Official Symbol
ZFYVE21
NCBI Official Synonym Symbols
ZF21; HCVP7TP1
NCBI Protein Information
zinc finger FYVE domain-containing protein 21
UniProt Protein Name
Zinc finger FYVE domain-containing protein 21
Protein Family
UniProt Gene Name
ZFYVE21
UniProt Synonym Gene Names
ZF21
UniProt Entry Name
ZFY21_HUMAN
Uniprot Description
ZFYVE21: Plays a role in cell adhesion, and thereby in cell motility, regulating microtubule-induced PTK2/FAK1 dephosphorylation, an event important for focal adhesion disassemblya, as well as integrin beta-1/ITGB1 cell surface expression. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: 14q32.33
Molecular Function: protein binding
Research Articles on ZFYVE21
Similar Products
Product Notes
The ZFYVE21 zfyve21 (Catalog #AAA1274221) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcctccg aggtgtccgc gcgccgcgac gccaagaagc tggtgcgctc cccgagcggc ctgcgcatgg tgcccgaaca ccgcgccttc ggaagcccgt tcggcctgga ggagccgcag tgggtcccgg acaaggagtg tcggagatgt atgcagtgtg acgccaagtt tgactttctc accagaaagc accactgtcg ccgctgcggg aagtgcttct gcgacaggtg ctgcagccag aaggtgccgc tgcggcgcat gtgctttgtg gaccccgtgc ggcagtgcgc ggagtgcgcc ctggtgtccc tcaaggaggc ggagttctac gacaagcagc tcaaagtgct cctgagcgga gccaccttcc tcgtcacgtt tggaaactca gagaaacctg aaactatgac ttgtcgtctt tccaataacc agagatactt gtttctggat ggagacagcc actatgaaat cgaaattgta cacatttcca ccgtgcagat cctcacagaa ggcttccctc ctggaggagg caacgcacgg gccacaggca tgttcctgca gtatacagtg ccggggacgg agggtgtgac ccagctgaag ctgacagtgg tggaggacgt gactgtgggc aggaggcagg cggtggcgtg gctagtggcc atgcacaagg ctgccaagct cctctatgaa tctcgggacc agtaa. It is sometimes possible for the material contained within the vial of "ZFYVE21, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
