Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZFYVE16 cdna clone

ZFYVE16 cDNA Clone

Gene Names
ZFYVE16; PPP1R69
Synonyms
ZFYVE16; ZFYVE16 cDNA Clone; ZFYVE16 cdna clone
Ordering
For Research Use Only!
Sequence
atggacagttattttaaagcagctgtcagtgacttggacaaactccttgatgattttgaacagaacccagatgaacaagattatctccaagatgtacaaaatgcatatgattctaaccactgctcagtttcttcagagttggcttcctcacagcgaacttcattgctcccaaaagaccaagagtgcgttaatagttgtgcctcatcagaaacaagctatggaacaaatgagagttccctgaataaaaaaacactcaagggacttacttctatacaaaatgaaaaaaatgtaacaggacttgatcttctttcttctgtggatggtggtacttcagatgaaatccagccgttatatatgggacgatgtagtaaacctatctgtgatctgataagtgacatgggtaacttagttcatgcaaccaatagtgaagaagatattaaaaaattattgccagatgattttaagtctaatgcagattccttgattggattggatttatcttcagtgtcagatactccctgtgtttcttcaacagaccatgatagcgatactgtcagagaacaacagaatgataccagttctgaattacaaaatagagaaatcggaggaatcaaagaattgggtataaaagtagatacaacactttcagattcctataattacagtggaacagaaaatttaaaagataaaaagatctttaatcagttagaatcaattgttgattttaacatgtcatctgctttgactcgacaaagttccaaaatgtttcatgccaaagacaagctacaacacaagagccagccatgtggattactaaaagatgttggcttagtaaaagaggaagtagatgtggcagtcataactgccgcagaatgtttaaaagaagagggcaagacaagtgctttgacctgcagccttccgaaaaatgaagatttatgcttaaatgattcaaattcaagagatgaaaatttcaaattacctgacttttcctttcaggaagataagactgttataaaacaatctgcacaagaagactcaaaaagtttagaccttaaggataatgatgtaatccaagattcctcttcagctttacatgtttccagtaaagatgtgccgtcctcattgtcctgtcttcctgcgtctgggtctatgtgtggatcattaattgaaagtaaagcacggggtgattttttacctcagcatgaacataaagataatatacaagatgcagtgactatacatgaagaaatacagaacagtgttgttctaggtggggaaccattcaaagagaatgatcttttgaaacaggaaaaatgtaaaagcatactccttcagtcattaattgaagggatggaagacagaaagatagatcctgaccagacagtaatcagagctgagtctttggatggtggtgacaccagttctacagttgtagaatctcaagaggggctttctggcactcatgtcccagagtcttctgattgttgtgaaggttttattaatactttttcaagcaatgatatggatgggcaagacttagattactttaatattgatgaaggcgcaaaaagtggcccactaattagtgatgctgaacttgatgcctttctgacagaacagtatcttcagaccactaacataaagtcttttgaagaaaatgtaaatgactctaaatcgcaaatgaatcagatagatatgaaaggcttagatgatggaaacatcaataatatatatttcaatgcagaagcaggagctattggggaaagtcatggtattaatataatttgtgaaacagttgataaacaaaatacaatagaaaatggcctttctttaggagaaaaaagcactattccagttcaacaagggttacctaccagtaagtctgagattacaaatcaattatcagtctctgatattaacagtcaatctgttggaggggccagacctaagcaattgtttagccttccatcaagaacaaggagttcaaaggacctgaataagccagatgttccagatacaatagaaagtgaacccagcacagcagataccgttgttccaatcacttgtgctatagattctacagctgatccacaggttagcttcaactctaattacattgatatagaaagtaattctgaaggtggatctagtttcgtaactgcaaatgaagattctgtacctgaaaacacttgcaaagaaggcttggttttgggccagaaacagcctacttgggttcctgattcagaagctccaaactgtatgaactgccaagtcaaatttacttttaccaaacggcgacaccattgccgagcatgtgggaaagtattttgtggtgtctgttgtaataggaagtgtaaactgcaatatctagaaaaggaagcaagagtatgtgtagtctgctatgaaactattagtaaaggtgagtgttaa
Sequence Length
2430
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
88,377 Da
NCBI Official Full Name
Homo sapiens zinc finger, FYVE domain containing 16, mRNA
NCBI Official Synonym Full Names
zinc finger FYVE-type containing 16
NCBI Official Symbol
ZFYVE16
NCBI Official Synonym Symbols
PPP1R69
NCBI Protein Information
zinc finger FYVE domain-containing protein 16
UniProt Protein Name
Zinc finger FYVE domain-containing protein 16
UniProt Gene Name
ZFYVE16
UniProt Synonym Gene Names
KIAA0305
UniProt Entry Name
ZFY16_HUMAN

NCBI Description

This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Uniprot Description

endofin: May be involved in regulating membrane trafficking in the endosomal pathway. Overexpression induces endosome aggregation. Required to target TOM1 to endosomes. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Lipid-binding

Chromosomal Location of Human Ortholog: 5q14

Cellular Component: cytoplasm; early endosome; early endosome membrane; intracellular membrane-bound organelle

Molecular Function: phosphatidylinositol binding; phosphatidylinositol-3,4,5-triphosphate binding; protein binding; protein transporter activity

Biological Process: BMP signaling pathway; endosome transport; protein targeting to lysosome; regulation of endocytosis

Research Articles on ZFYVE16

Similar Products

Product Notes

The ZFYVE16 zfyve16 (Catalog #AAA1278676) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagtt attttaaagc agctgtcagt gacttggaca aactccttga tgattttgaa cagaacccag atgaacaaga ttatctccaa gatgtacaaa atgcatatga ttctaaccac tgctcagttt cttcagagtt ggcttcctca cagcgaactt cattgctccc aaaagaccaa gagtgcgtta atagttgtgc ctcatcagaa acaagctatg gaacaaatga gagttccctg aataaaaaaa cactcaaggg acttacttct atacaaaatg aaaaaaatgt aacaggactt gatcttcttt cttctgtgga tggtggtact tcagatgaaa tccagccgtt atatatggga cgatgtagta aacctatctg tgatctgata agtgacatgg gtaacttagt tcatgcaacc aatagtgaag aagatattaa aaaattattg ccagatgatt ttaagtctaa tgcagattcc ttgattggat tggatttatc ttcagtgtca gatactccct gtgtttcttc aacagaccat gatagcgata ctgtcagaga acaacagaat gataccagtt ctgaattaca aaatagagaa atcggaggaa tcaaagaatt gggtataaaa gtagatacaa cactttcaga ttcctataat tacagtggaa cagaaaattt aaaagataaa aagatcttta atcagttaga atcaattgtt gattttaaca tgtcatctgc tttgactcga caaagttcca aaatgtttca tgccaaagac aagctacaac acaagagcca gccatgtgga ttactaaaag atgttggctt agtaaaagag gaagtagatg tggcagtcat aactgccgca gaatgtttaa aagaagaggg caagacaagt gctttgacct gcagccttcc gaaaaatgaa gatttatgct taaatgattc aaattcaaga gatgaaaatt tcaaattacc tgacttttcc tttcaggaag ataagactgt tataaaacaa tctgcacaag aagactcaaa aagtttagac cttaaggata atgatgtaat ccaagattcc tcttcagctt tacatgtttc cagtaaagat gtgccgtcct cattgtcctg tcttcctgcg tctgggtcta tgtgtggatc attaattgaa agtaaagcac ggggtgattt tttacctcag catgaacata aagataatat acaagatgca gtgactatac atgaagaaat acagaacagt gttgttctag gtggggaacc attcaaagag aatgatcttt tgaaacagga aaaatgtaaa agcatactcc ttcagtcatt aattgaaggg atggaagaca gaaagataga tcctgaccag acagtaatca gagctgagtc tttggatggt ggtgacacca gttctacagt tgtagaatct caagaggggc tttctggcac tcatgtccca gagtcttctg attgttgtga aggttttatt aatacttttt caagcaatga tatggatggg caagacttag attactttaa tattgatgaa ggcgcaaaaa gtggcccact aattagtgat gctgaacttg atgcctttct gacagaacag tatcttcaga ccactaacat aaagtctttt gaagaaaatg taaatgactc taaatcgcaa atgaatcaga tagatatgaa aggcttagat gatggaaaca tcaataatat atatttcaat gcagaagcag gagctattgg ggaaagtcat ggtattaata taatttgtga aacagttgat aaacaaaata caatagaaaa tggcctttct ttaggagaaa aaagcactat tccagttcaa caagggttac ctaccagtaa gtctgagatt acaaatcaat tatcagtctc tgatattaac agtcaatctg ttggaggggc cagacctaag caattgttta gccttccatc aagaacaagg agttcaaagg acctgaataa gccagatgtt ccagatacaa tagaaagtga acccagcaca gcagataccg ttgttccaat cacttgtgct atagattcta cagctgatcc acaggttagc ttcaactcta attacattga tatagaaagt aattctgaag gtggatctag tttcgtaact gcaaatgaag attctgtacc tgaaaacact tgcaaagaag gcttggtttt gggccagaaa cagcctactt gggttcctga ttcagaagct ccaaactgta tgaactgcca agtcaaattt acttttacca aacggcgaca ccattgccga gcatgtggga aagtattttg tggtgtctgt tgtaatagga agtgtaaact gcaatatcta gaaaaggaag caagagtatg tgtagtctgc tatgaaacta ttagtaaagg tgagtgttaa. It is sometimes possible for the material contained within the vial of "ZFYVE16, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.