Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZFC3H1 cdna clone

ZFC3H1 cDNA Clone

Gene Names
ZFC3H1; CSRC2; PSRC2; CCDC131
Synonyms
ZFC3H1; ZFC3H1 cDNA Clone; ZFC3H1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaccgcagatactccggccccggcctccagtggcctctcgccgaaggaagaaggggagcttgaagatggggaaatcagtgacgacgataataacagccagatacggagtcggagcagcagcagcagcagcggcggcgggctgttaccctatccgcggcgaaggcctcctcactcggcccggggcggtggatctggcggaggcggtggctcttcctcgtcatcgtcctcttctcagcagcagctgaggaatttctcacgctcgcggcacgcgtctgagcggggccacctcaggggacccagcagctaccgacccaaagaaccgttccggtctcatccgccttctgtacggatgccttcgagctcactgtccgaaagcagtccccggccgtctttctgggagcggagccacctcgccttggaccgtttccgctttcgaggcaggccttaccggggtgggagtcgctggagtcgggggcgaggagtgggtgagcgaggaggcaagccggggtgcagacctcctctgggaggaggagcaggatccgggttcagcagcagtcagagctggcgagagccctctccacctcggaagagctccaaaagttttggaaggtctccatcaagaaaacaaaattattcatcaaaaaatgaaaactgtgtggaagaaacttttgaagatttgcttttaaagtataaacaaatacagttggaactagaatgcatcaataaggatgaaaaactagcattgagtagcaaagaagagaatgtgcaggaagatcctaaaacattgaacttcgaggaccaaactagcactgataatgtcagtattacaaaggattcaagtaaagaagtagctcctgaggagaaaacacaagtcaaaacttttcaggcatttgaattaaaaccactcaggcaaaaattgactttaccaggagataagaaccgtttgaaaaaagttaaagatggagcaaaaccactttccctgaaatccgacactactgattctagtcaaggtaatggaattaaatatttcagttag
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
37,841 Da
NCBI Official Full Name
Homo sapiens zinc finger, C3H1-type containing, mRNA
NCBI Official Synonym Full Names
zinc finger C3H1-type containing
NCBI Official Symbol
ZFC3H1
NCBI Official Synonym Symbols
CSRC2; PSRC2; CCDC131
NCBI Protein Information
zinc finger C3H1 domain-containing protein
UniProt Protein Name
Zinc finger C3H1 domain-containing protein
UniProt Gene Name
ZFC3H1
UniProt Synonym Gene Names
CCDC131; KIAA0546; PSRC2
UniProt Entry Name
ZC3H1_HUMAN

Uniprot Description

PSRC2: a protein containing 6 HAT and 5 TPR repeats.

Protein type: Cytoskeletal

Chromosomal Location of Human Ortholog: 12q21.1

Cellular Component: extracellular space

Molecular Function: protein binding

Research Articles on ZFC3H1

Similar Products

Product Notes

The ZFC3H1 zfc3h1 (Catalog #AAA1275024) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaccg cagatactcc ggccccggcc tccagtggcc tctcgccgaa ggaagaaggg gagcttgaag atggggaaat cagtgacgac gataataaca gccagatacg gagtcggagc agcagcagca gcagcggcgg cgggctgtta ccctatccgc ggcgaaggcc tcctcactcg gcccggggcg gtggatctgg cggaggcggt ggctcttcct cgtcatcgtc ctcttctcag cagcagctga ggaatttctc acgctcgcgg cacgcgtctg agcggggcca cctcagggga cccagcagct accgacccaa agaaccgttc cggtctcatc cgccttctgt acggatgcct tcgagctcac tgtccgaaag cagtccccgg ccgtctttct gggagcggag ccacctcgcc ttggaccgtt tccgctttcg aggcaggcct taccggggtg ggagtcgctg gagtcggggg cgaggagtgg gtgagcgagg aggcaagccg gggtgcagac ctcctctggg aggaggagca ggatccgggt tcagcagcag tcagagctgg cgagagccct ctccacctcg gaagagctcc aaaagttttg gaaggtctcc atcaagaaaa caaaattatt catcaaaaaa tgaaaactgt gtggaagaaa cttttgaaga tttgctttta aagtataaac aaatacagtt ggaactagaa tgcatcaata aggatgaaaa actagcattg agtagcaaag aagagaatgt gcaggaagat cctaaaacat tgaacttcga ggaccaaact agcactgata atgtcagtat tacaaaggat tcaagtaaag aagtagctcc tgaggagaaa acacaagtca aaacttttca ggcatttgaa ttaaaaccac tcaggcaaaa attgacttta ccaggagata agaaccgttt gaaaaaagtt aaagatggag caaaaccact ttccctgaaa tccgacacta ctgattctag tcaaggtaat ggaattaaat atttcagtta g. It is sometimes possible for the material contained within the vial of "ZFC3H1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.