Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZDHHC8 cdna clone

ZDHHC8 cDNA Clone

Gene Names
ZDHHC8; DHHC8; ZNF378; ZDHHCL1
Synonyms
ZDHHC8; ZDHHC8 cDNA Clone; ZDHHC8 cdna clone
Ordering
For Research Use Only!
Sequence
atggacagaggcacccagggcccccaccgtccttctgacacagcctgtgggctcccggaccgagtgtcccccgccaggctactcctaactaacgcgttgcctttcacggaccccgctggaagcttgtag
Sequence Length
129
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
83,173 Da
NCBI Official Full Name
Homo sapiens zinc finger, DHHC-type containing 8, mRNA
NCBI Official Synonym Full Names
zinc finger DHHC-type containing 8
NCBI Official Symbol
ZDHHC8
NCBI Official Synonym Symbols
DHHC8; ZNF378; ZDHHCL1
NCBI Protein Information
probable palmitoyltransferase ZDHHC8
UniProt Protein Name
Probable palmitoyltransferase ZDHHC8
UniProt Gene Name
ZDHHC8
UniProt Synonym Gene Names
KIAA1292; ZDHHCL1; ZNF378; DHHC-8
UniProt Entry Name
ZDHC8_HUMAN

NCBI Description

This gene encodes a four transmembrane protein that is a member of the zinc finger DHHC domain-containing protein family. The encoded protein may function as a palmitoyltransferase. Defects in this gene may be associated with a susceptibility to schizophrenia. Alternate splicing of this gene results in multiple transcript variants. A pseudogene of this gene is found on chromosome 22.[provided by RefSeq, May 2010]

Uniprot Description

ZDHHC8: Palmitoyltransferase involved in glutamatergic transmission. Mediates palmitoylation of ABCA1. Belongs to the DHHC palmitoyltransferase family. ERF2/ZDHHC9 subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; Membrane protein, integral; Membrane protein, multi-pass; EC 2.3.1.225

Chromosomal Location of Human Ortholog: 22q11.21

Cellular Component: cytosol; Golgi apparatus

Molecular Function: palmitoyltransferase activity; protein-cysteine S-palmitoleyltransferase activity

Biological Process: lipoprotein metabolic process; protein palmitoylation

Research Articles on ZDHHC8

Similar Products

Product Notes

The ZDHHC8 zdhhc8 (Catalog #AAA1275515) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagag gcacccaggg cccccaccgt ccttctgaca cagcctgtgg gctcccggac cgagtgtccc ccgccaggct actcctaact aacgcgttgc ctttcacgga ccccgctgga agcttgtag. It is sometimes possible for the material contained within the vial of "ZDHHC8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.