Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZC4H2 cdna clone

ZC4H2 cDNA Clone

Gene Names
ZC4H2; WWS; WRWF; HCA127; KIAA1166
Synonyms
ZC4H2; ZC4H2 cDNA Clone; ZC4H2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagatgagcaagaaatcatgtgcaaattggaaagcattaaagagatcaggaacaagaccctgcagatggagaagatcaaggctcgtttgaaggctgagtttgaggcacttgagtcagaggaaaggcacctgaaggaatacaagcaggagatggaccttctgctacaggagaagatggcccatgtggaggaactccgactgatccacgctgacatcaatgtgatggaaaacactatcaaacaatctgagaatgacctaaacaagctgctagagtctacaaggaggctgcatgatgagtataagccactgaaagaacatgtggatgccctgcgcatgactctgggcctgcagaggctccctgacttgtgtgaagaagaggagaagctttccttggattactttgagaagcagaaagcagaatggcagacagaacctcaggagccccccatccctgagtccctggccgctgcagccgctgccgcccaacagctccaagtggctaggaagcaggatactcggcagacggccaccttcaggcagcagcccccacctatgaaggcctgcttgtcatgtcaccagcaaattcaccggaatgcacctatatgccctctttgcaaggccaagagtcggtcccggaaccccaaaaagccgaaacggaagcaggatgaataa
Sequence Length
675
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,738 Da
NCBI Official Full Name
Homo sapiens zinc finger, C4H2 domain containing, mRNA
NCBI Official Synonym Full Names
zinc finger C4H2-type containing
NCBI Official Symbol
ZC4H2
NCBI Official Synonym Symbols
WWS; WRWF; HCA127; KIAA1166
NCBI Protein Information
zinc finger C4H2 domain-containing protein
UniProt Protein Name
Zinc finger C4H2 domain-containing protein
UniProt Gene Name
ZC4H2
UniProt Synonym Gene Names
HCA127; KIAA1166
UniProt Entry Name
ZC4H2_HUMAN

NCBI Description

This gene encodes a member of the zinc finger domain-containing protein family. This family member has a C-terminal zinc finger domain that is characterized by four cysteine residues and two histidine residues, and it also includes a coiled-coil region. This protein has been detected as an autoantigen in hepatocellular carcinoma patients. This gene has been identified as a potential candidate for X-linked mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Uniprot Description

ZC4H2: a member of the zinc finger domain-containing protein family. This family member has a C-terminal zinc finger domain that is characterized by four cysteine residues and two histidine residues, and it also includes a coiled-coil region. This protein has been detected as an autoantigen in hepatocellular carcinoma patients. This gene has been identified as a potential candidate for X-linked mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]

Chromosomal Location of Human Ortholog: Xq11.2

Cellular Component: cytoplasm; nucleus; postsynaptic membrane

Molecular Function: protein binding

Biological Process: nervous system development; neuromuscular junction development; spinal cord motor neuron differentiation

Research Articles on ZC4H2

Similar Products

Product Notes

The ZC4H2 zc4h2 (Catalog #AAA1277204) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagatg agcaagaaat catgtgcaaa ttggaaagca ttaaagagat caggaacaag accctgcaga tggagaagat caaggctcgt ttgaaggctg agtttgaggc acttgagtca gaggaaaggc acctgaagga atacaagcag gagatggacc ttctgctaca ggagaagatg gcccatgtgg aggaactccg actgatccac gctgacatca atgtgatgga aaacactatc aaacaatctg agaatgacct aaacaagctg ctagagtcta caaggaggct gcatgatgag tataagccac tgaaagaaca tgtggatgcc ctgcgcatga ctctgggcct gcagaggctc cctgacttgt gtgaagaaga ggagaagctt tccttggatt actttgagaa gcagaaagca gaatggcaga cagaacctca ggagcccccc atccctgagt ccctggccgc tgcagccgct gccgcccaac agctccaagt ggctaggaag caggatactc ggcagacggc caccttcagg cagcagcccc cacctatgaa ggcctgcttg tcatgtcacc agcaaattca ccggaatgca cctatatgcc ctctttgcaa ggccaagagt cggtcccgga accccaaaaa gccgaaacgg aagcaggatg aataa. It is sometimes possible for the material contained within the vial of "ZC4H2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.