Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZC3HAV1L cdna clone

ZC3HAV1L cDNA Clone

Gene Names
ZC3HAV1L; C7orf39
Synonyms
ZC3HAV1L; ZC3HAV1L cDNA Clone; ZC3HAV1L cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagcccacagtgtgctccttcctcaccaaggtgctgtgcgcccacggcggccgcatgttcctgaaggacctgcgcggccacgtggagctgtcggaggccaggctccgggacgtgctgcagcgcgccgggcccgagcgtttcctgctgcaggaggtggagacgcaggagggcctcggggacgcggaggccgaggcggcggccggcgcggtgggcggtggcggcacctccgcctggagggtggtggccgtgtcctctgtgcgcctctgcgcccgctaccagcgcggcgagtgccaggcctgcgaccagctgcacttctgccgccggcacatgctgggcaagtgccccaaccgggactgctggtctacctgtaccctttcccatgatatccacacacctgtcaacatgcaggtcctgaaaagccatggactttttggtctcaatgaaaaccagcttcggatcctgcttttgcagaatgacccctgtcttttaccagaggtctgtttgctctacaacaaaggggaagccctgtatggctactgcaacctcaaggataaatgcaacaagtttcatgtgtgcaaatcctttgtgaaaggagaatgcaaacttcagacctgcaaacggtcccatcagcttatccatgctgcatctttgaagctgctacaggaccaaggactgaatattccaagtgttgttaattttcagataatctccacctacaagcatataaagctgcacaagatgcttgaaaatacagataattcatcaccttcgactgagcattcacaaggccttgagaagcaaggagtgcacgcagctggagctgcagaagctggtcctctggcttctgtccctgctcagtcggccaagaagccctgcccagtgtcttgcgagaagtaa
Sequence Length
903
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,778 Da
NCBI Official Full Name
Homo sapiens zinc finger CCCH-type, antiviral 1-like, mRNA
NCBI Official Synonym Full Names
zinc finger CCCH-type containing, antiviral 1 like
NCBI Official Symbol
ZC3HAV1L
NCBI Official Synonym Symbols
C7orf39
NCBI Protein Information
zinc finger CCCH-type antiviral protein 1-like
UniProt Protein Name
Zinc finger CCCH-type antiviral protein 1-like
UniProt Gene Name
ZC3HAV1L
UniProt Synonym Gene Names
C7orf39
UniProt Entry Name
ZCCHL_HUMAN

Uniprot Description

ZC3HAV1L: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 7q34

Research Articles on ZC3HAV1L

Similar Products

Product Notes

The ZC3HAV1L zc3hav1l (Catalog #AAA1277894) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagc ccacagtgtg ctccttcctc accaaggtgc tgtgcgccca cggcggccgc atgttcctga aggacctgcg cggccacgtg gagctgtcgg aggccaggct ccgggacgtg ctgcagcgcg ccgggcccga gcgtttcctg ctgcaggagg tggagacgca ggagggcctc ggggacgcgg aggccgaggc ggcggccggc gcggtgggcg gtggcggcac ctccgcctgg agggtggtgg ccgtgtcctc tgtgcgcctc tgcgcccgct accagcgcgg cgagtgccag gcctgcgacc agctgcactt ctgccgccgg cacatgctgg gcaagtgccc caaccgggac tgctggtcta cctgtaccct ttcccatgat atccacacac ctgtcaacat gcaggtcctg aaaagccatg gactttttgg tctcaatgaa aaccagcttc ggatcctgct tttgcagaat gacccctgtc ttttaccaga ggtctgtttg ctctacaaca aaggggaagc cctgtatggc tactgcaacc tcaaggataa atgcaacaag tttcatgtgt gcaaatcctt tgtgaaagga gaatgcaaac ttcagacctg caaacggtcc catcagctta tccatgctgc atctttgaag ctgctacagg accaaggact gaatattcca agtgttgtta attttcagat aatctccacc tacaagcata taaagctgca caagatgctt gaaaatacag ataattcatc accttcgact gagcattcac aaggccttga gaagcaagga gtgcacgcag ctggagctgc agaagctggt cctctggctt ctgtccctgc tcagtcggcc aagaagccct gcccagtgtc ttgcgagaag taa. It is sometimes possible for the material contained within the vial of "ZC3HAV1L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.