ZBTB46 cdna clone
ZBTB46 cDNA Clone
Gene Names
ZBTB46; BZEL; BTBD4; RINZF; ZNF340; dJ583P15.7; dJ583P15.8
Synonyms
ZBTB46; ZBTB46 cDNA Clone; ZBTB46 cdna clone
Sequence
atgaacaaccgaaaggaagatatggaaatcgcgtcccactaccggcacctgctgcgggagctcaacgagcagaggcagcacggcgtcctgtgcgacgtctgcgtggtcgtggagggcaaggtcttcaaggcgcacaagaacgtcctgctgggcagcagccgctacttcaagacgctctactgccaggtgcagaagacgtcggagcaggccacggtcacgcacctggacatcgtcacggcccagggcttcaaggccatcatcgacttcatgtactcagcgcacctggcgctcaccagcaggaacgtcatcgaggtgatgtcagccgccagcttcctgcagatgacggacatcgtgcaagcctgccacgacttcatcaaggcggcgctggacatcagcatcaagtcggacgcctcagatgagcttgcggagttcgagatcggcgcctcgtccagcagcagcacggaagctctcatctcggccgtgatggccgggaggagcatctccccgtggctggcacggcgaacgagtcctgccaattcttccggagactcggccatcgccagctgtcacgacggagggagcagctacgggaaagaggatcaggagcccaaggccgatggccctgatgatgtttcttcacagcctctatggcctggagacgtgggctacgggcctctgcgcatcaaggaagagcaggtttcaccgtctcagtacggagggagcgagctgccttctgccaaggacggtgcagtacagaactctttctcagagcagagtgctggtgatgcctggcagcccacgggccgaaggaagaatcggaaaaacaaagagaccgtccggcacatcacacagcaggtggaagatgacagccgggccagctccccggtgccgtccttcctgccgacgtcggggtggccgttcagcagccgagactcaaatgcggacctgtccgtcaccgaagccagcagctccgacagccgaggagagagggccgagctctatgcacaggtggaggagggtctcctgggaggagaagccagctatctgggccctcccctcaccccagagaaggacgacgccctgcatcaggccaccgcggtggccaacctgcgcgcggcgctcatgagtaagaacagcctgctgtcgctgaaggccgacgtgctgggggatgacggctccctgctgttcgagtacctgcccagaggggcccactcgctgtccctgaatgagttcacggtgatcaggaagaagttcaagtgtccgtactgcagcttctcggccatgcaccagtgcatcctcaagcgacacatgcgctcgcacacgggagagcggccctacccctgcgagatctgcgggaagaagttcacgcggcgcgagcacatgaagcgccacacgctggtccacagcaaggacaagaagtatgtgtgcaaggtgtgcagccgcgtcttcatgtccgccgccagcgtgggcatcaggcatggctccaggcgccacggtgtgtgcaccgactgtgctggccgcggcatggccgggcccctggaccatggcggcggaggcggcgagggctctccagaggcgctgttcccaggcgacgggccctatctggaggaccctgaggacccacgaggggaggcggaggagctgggcgaggacgacgagggcctggcccctgaggatgcgctgttggcggacgacaaggatgaggaagactcgccgcggccgcgcagccccccaggaggccctgacaaggacttcgcctggctctcctag
Sequence Length
1770
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
64,083 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 46, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 46
NCBI Official Symbol
ZBTB46
NCBI Official Synonym Symbols
BZEL; BTBD4; RINZF; ZNF340; dJ583P15.7; dJ583P15.8
NCBI Protein Information
zinc finger and BTB domain-containing protein 46
UniProt Protein Name
Zinc finger and BTB domain-containing protein 46
Protein Family
UniProt Gene Name
ZBTB46
UniProt Synonym Gene Names
BTBD4; ZNF340; BZEL
UniProt Entry Name
ZBT46_HUMAN
Uniprot Description
ZBTB46: Function as a transcriptional repressor for PRDM1.
Protein type: C2H2-type zinc finger protein
Chromosomal Location of Human Ortholog: 20q13.33
Research Articles on ZBTB46
Similar Products
Product Notes
The ZBTB46 zbtb46 (Catalog #AAA1266641) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacaacc gaaaggaaga tatggaaatc gcgtcccact accggcacct gctgcgggag ctcaacgagc agaggcagca cggcgtcctg tgcgacgtct gcgtggtcgt ggagggcaag gtcttcaagg cgcacaagaa cgtcctgctg ggcagcagcc gctacttcaa gacgctctac tgccaggtgc agaagacgtc ggagcaggcc acggtcacgc acctggacat cgtcacggcc cagggcttca aggccatcat cgacttcatg tactcagcgc acctggcgct caccagcagg aacgtcatcg aggtgatgtc agccgccagc ttcctgcaga tgacggacat cgtgcaagcc tgccacgact tcatcaaggc ggcgctggac atcagcatca agtcggacgc ctcagatgag cttgcggagt tcgagatcgg cgcctcgtcc agcagcagca cggaagctct catctcggcc gtgatggccg ggaggagcat ctccccgtgg ctggcacggc gaacgagtcc tgccaattct tccggagact cggccatcgc cagctgtcac gacggaggga gcagctacgg gaaagaggat caggagccca aggccgatgg ccctgatgat gtttcttcac agcctctatg gcctggagac gtgggctacg ggcctctgcg catcaaggaa gagcaggttt caccgtctca gtacggaggg agcgagctgc cttctgccaa ggacggtgca gtacagaact ctttctcaga gcagagtgct ggtgatgcct ggcagcccac gggccgaagg aagaatcgga aaaacaaaga gaccgtccgg cacatcacac agcaggtgga agatgacagc cgggccagct ccccggtgcc gtccttcctg ccgacgtcgg ggtggccgtt cagcagccga gactcaaatg cggacctgtc cgtcaccgaa gccagcagct ccgacagccg aggagagagg gccgagctct atgcacaggt ggaggagggt ctcctgggag gagaagccag ctatctgggc cctcccctca ccccagagaa ggacgacgcc ctgcatcagg ccaccgcggt ggccaacctg cgcgcggcgc tcatgagtaa gaacagcctg ctgtcgctga aggccgacgt gctgggggat gacggctccc tgctgttcga gtacctgccc agaggggccc actcgctgtc cctgaatgag ttcacggtga tcaggaagaa gttcaagtgt ccgtactgca gcttctcggc catgcaccag tgcatcctca agcgacacat gcgctcgcac acgggagagc ggccctaccc ctgcgagatc tgcgggaaga agttcacgcg gcgcgagcac atgaagcgcc acacgctggt ccacagcaag gacaagaagt atgtgtgcaa ggtgtgcagc cgcgtcttca tgtccgccgc cagcgtgggc atcaggcatg gctccaggcg ccacggtgtg tgcaccgact gtgctggccg cggcatggcc gggcccctgg accatggcgg cggaggcggc gagggctctc cagaggcgct gttcccaggc gacgggccct atctggagga ccctgaggac ccacgagggg aggcggagga gctgggcgag gacgacgagg gcctggcccc tgaggatgcg ctgttggcgg acgacaagga tgaggaagac tcgccgcggc cgcgcagccc cccaggaggc cctgacaagg acttcgcctg gctctcctag. It is sometimes possible for the material contained within the vial of "ZBTB46, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
