Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBTB44 cdna clone

ZBTB44 cDNA Clone

Gene Names
ZBTB44; BTBD15; ZNF851; HSPC063
Synonyms
ZBTB44; ZBTB44 cDNA Clone; ZBTB44 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtgtgaaaacatttactcatagctcctcttcccacagccaggaaatgcttggaaagctaaatatgctgcgaaatgatggacatttttgtgatatcactattcgtgtccaggacaaaatcttccgggcacataaggtggtactagcagcttgcagtgatttctttcgcaccaaacttgtaggccaagccgaggatgagaacaagaatgtgttggatctgcatcatgttacagtgactggctttatacctcttttagaatatgcttacacagccactctatcaattaacacagaaaatattattgatgttctagcagcagccagctatatgcaaatgttcagtgttgccagcacctgctcagagttcatgaaatcaagcattttatggaatacacccaacagccaacctgaaaagggtctagatgctggacaagaaaataattctaactgcaattttacttctcgagatgggagcatttctcccgtgtcctcagagtgcagtgtggtagaaagaaccattcctgtctgccgagaatcccggagaaagcgcgaaagctacattgttatgtctcctgaaagtcctgtaaagtgtggcacacaaacaagctcaccccaggtattgaattcttcagcttcctactcagaaaatagaaaccaaccagttgactcttccttagcttttccttggacttttccttttggaattgatcgaaggattcagcctgagaaagttaagcaagcagaaaatacccggactttagaattacctggcccatctgagaccggtagaagaatggctgattatgtgacttgtgagagcacaaaaactaccttgcctttaggtaccgaagaagatgtccgggtcaaagtagaaagattaagtgatgaggaggtccatgaggaagtgtcccagcctgtcagtgcatctcagagttcgctgagtgatcagcagacagttccaggaagtgaacaagtccaagaggaccttctgattagtccacagtcttcctctataggctcagtagatgaaggcgtttctgagggcttgcctacacttcaaagcacgtctagcactaatgctcctccggatgatgatgatcgattggaaaatgttcagtatccctaccaactctacattgctccttccaccagcagtacagagcgaccaagtccaaatggtcccgacagaccttttcagtgtccaacctgcggggtgcgattcacccgtattcagaacctaaagcagcacatgctcatccactcaggaattaaaccatttcagtgtgaccgctgtgggaaaaagttcaccagggcttactcgctaaagatgcatcgcctaaagcatgaagggcatcccaggaaatcagcttctagatctagctctgccactaactgctgttga
Sequence Length
1404
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,765 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 44, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 44
NCBI Official Symbol
ZBTB44
NCBI Official Synonym Symbols
BTBD15; ZNF851; HSPC063
NCBI Protein Information
zinc finger and BTB domain-containing protein 44
UniProt Protein Name
Zinc finger and BTB domain-containing protein 44
UniProt Gene Name
ZBTB44
UniProt Synonym Gene Names
BTBD15; ZNF851
UniProt Entry Name
ZBT44_HUMAN

Uniprot Description

ZBTB44: May be involved in transcriptional regulation. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 11q24.3

Molecular Function: protein binding

Similar Products

Product Notes

The ZBTB44 zbtb44 (Catalog #AAA1274219) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtgtga aaacatttac tcatagctcc tcttcccaca gccaggaaat gcttggaaag ctaaatatgc tgcgaaatga tggacatttt tgtgatatca ctattcgtgt ccaggacaaa atcttccggg cacataaggt ggtactagca gcttgcagtg atttctttcg caccaaactt gtaggccaag ccgaggatga gaacaagaat gtgttggatc tgcatcatgt tacagtgact ggctttatac ctcttttaga atatgcttac acagccactc tatcaattaa cacagaaaat attattgatg ttctagcagc agccagctat atgcaaatgt tcagtgttgc cagcacctgc tcagagttca tgaaatcaag cattttatgg aatacaccca acagccaacc tgaaaagggt ctagatgctg gacaagaaaa taattctaac tgcaatttta cttctcgaga tgggagcatt tctcccgtgt cctcagagtg cagtgtggta gaaagaacca ttcctgtctg ccgagaatcc cggagaaagc gcgaaagcta cattgttatg tctcctgaaa gtcctgtaaa gtgtggcaca caaacaagct caccccaggt attgaattct tcagcttcct actcagaaaa tagaaaccaa ccagttgact cttccttagc ttttccttgg acttttcctt ttggaattga tcgaaggatt cagcctgaga aagttaagca agcagaaaat acccggactt tagaattacc tggcccatct gagaccggta gaagaatggc tgattatgtg acttgtgaga gcacaaaaac taccttgcct ttaggtaccg aagaagatgt ccgggtcaaa gtagaaagat taagtgatga ggaggtccat gaggaagtgt cccagcctgt cagtgcatct cagagttcgc tgagtgatca gcagacagtt ccaggaagtg aacaagtcca agaggacctt ctgattagtc cacagtcttc ctctataggc tcagtagatg aaggcgtttc tgagggcttg cctacacttc aaagcacgtc tagcactaat gctcctccgg atgatgatga tcgattggaa aatgttcagt atccctacca actctacatt gctccttcca ccagcagtac agagcgacca agtccaaatg gtcccgacag accttttcag tgtccaacct gcggggtgcg attcacccgt attcagaacc taaagcagca catgctcatc cactcaggaa ttaaaccatt tcagtgtgac cgctgtggga aaaagttcac cagggcttac tcgctaaaga tgcatcgcct aaagcatgaa gggcatccca ggaaatcagc ttctagatct agctctgcca ctaactgctg ttga. It is sometimes possible for the material contained within the vial of "ZBTB44, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.