Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZBTB26 cdna clone

ZBTB26 cDNA Clone

Gene Names
ZBTB26; ZNF481; bioref
Synonyms
ZBTB26; ZBTB26 cDNA Clone; ZBTB26 cdna clone
Ordering
For Research Use Only!
Sequence
atgtctgaaagatcagatctccttcacttcaagtttgaaaattatggagattcaatgttacaaaaaatgaacaaattaagagaagagaataaattttgtgatgttacagttctcatagatgatattgaggtacagggacataaaattgtgtttgctgcaggttcccccttcttaagagaccaatttttactgaatgattccagagaggtgaaaatctccatattacagagttccgaagtggggagacaattgctcttatcctgttatagtggtgtgctggaattccctgagatggaactggtaaattacttgactgctgcaagttttcttcagatgagccacattgtagaacggtgcacacaggccctgtggaagtttataaagccaaaacaaccaatggatagtaaagagggatgtgaaccacagagtgcttctccccagtcaaaagaacagcagggagatgccagaggctccccaaagcaggactcaccttgtattcatccatctgaagacagtatggatatggaggacagtgatattcagattgttaaggtagaatctattggggatgtatcagaggttagaagtaaaaaagatcagaaccagtttatttcttctgaacccactgctttacattcatcagagccccagcactccctgataaattcaactgtggaaaacagagtaagtgaaatagaacaaaaccatctccacaattatgccctttcttatacaggcagtgataacatcatcatggcctcaaaagatgtctttggccctaatattcgaggtgtagacaaaggcctacagtggcatcaccagtgcccaaagtgtaccagggtgtttcgtcacctggagaactacgccaaccatttaaaaatgcacaaactctttatgtgtctactctgcggcaagactttcactcagaaaggcaaccttcatcgacacatgcgtgtgcatgccggaattaaacctttccagtgtaaaatctgtgggaaaaccttttctcagaagtgttccttacaggatcatcttaaccttcacagtggagataagccccataaatgtaactattgtgatatggtttttgcacataaaccagttttgaggaaacaccttaaacagctgcatggcaaaaacagctttgataatgccaatgagagaaatgtacaagacctcacagtggattttgattcttttgcatgtacaacagtcacagactctaaagggtgtcagccacaacccgatgcaacacaggtcctggatgcaggtaaactggcccaagctgtcctgaacttaagaaatgatagtacttgtgtgaattga
Sequence Length
1326
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,953 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 26, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 26
NCBI Official Symbol
ZBTB26
NCBI Official Synonym Symbols
ZNF481; bioref
NCBI Protein Information
zinc finger and BTB domain-containing protein 26
UniProt Protein Name
Zinc finger and BTB domain-containing protein 26
UniProt Gene Name
ZBTB26
UniProt Synonym Gene Names
KIAA1572; ZNF481
UniProt Entry Name
ZBT26_HUMAN

Uniprot Description

ZBTB26: May be involved in transcriptional regulation.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 9q33.2

Molecular Function: protein binding

Similar Products

Product Notes

The ZBTB26 zbtb26 (Catalog #AAA1275463) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgaaa gatcagatct ccttcacttc aagtttgaaa attatggaga ttcaatgtta caaaaaatga acaaattaag agaagagaat aaattttgtg atgttacagt tctcatagat gatattgagg tacagggaca taaaattgtg tttgctgcag gttccccctt cttaagagac caatttttac tgaatgattc cagagaggtg aaaatctcca tattacagag ttccgaagtg gggagacaat tgctcttatc ctgttatagt ggtgtgctgg aattccctga gatggaactg gtaaattact tgactgctgc aagttttctt cagatgagcc acattgtaga acggtgcaca caggccctgt ggaagtttat aaagccaaaa caaccaatgg atagtaaaga gggatgtgaa ccacagagtg cttctcccca gtcaaaagaa cagcagggag atgccagagg ctccccaaag caggactcac cttgtattca tccatctgaa gacagtatgg atatggagga cagtgatatt cagattgtta aggtagaatc tattggggat gtatcagagg ttagaagtaa aaaagatcag aaccagttta tttcttctga acccactgct ttacattcat cagagcccca gcactccctg ataaattcaa ctgtggaaaa cagagtaagt gaaatagaac aaaaccatct ccacaattat gccctttctt atacaggcag tgataacatc atcatggcct caaaagatgt ctttggccct aatattcgag gtgtagacaa aggcctacag tggcatcacc agtgcccaaa gtgtaccagg gtgtttcgtc acctggagaa ctacgccaac catttaaaaa tgcacaaact ctttatgtgt ctactctgcg gcaagacttt cactcagaaa ggcaaccttc atcgacacat gcgtgtgcat gccggaatta aacctttcca gtgtaaaatc tgtgggaaaa ccttttctca gaagtgttcc ttacaggatc atcttaacct tcacagtgga gataagcccc ataaatgtaa ctattgtgat atggtttttg cacataaacc agttttgagg aaacacctta aacagctgca tggcaaaaac agctttgata atgccaatga gagaaatgta caagacctca cagtggattt tgattctttt gcatgtacaa cagtcacaga ctctaaaggg tgtcagccac aacccgatgc aacacaggtc ctggatgcag gtaaactggc ccaagctgtc ctgaacttaa gaaatgatag tacttgtgtg aattga. It is sometimes possible for the material contained within the vial of "ZBTB26, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.