Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ZAP70 cdna clone

ZAP70 cDNA Clone

Gene Names
ZAP70; SRK; STD; TZK; STCD; IMD48; ADMIO2; ZAP-70
Synonyms
ZAP70; ZAP70 cDNA Clone; ZAP70 cdna clone
Ordering
For Research Use Only!
Sequence
atgccagaccccgcggcgcacctgcccttcttctacggcagcatctcgcgtgccgaggccgaggagcacctgaagctggcgggcatggcggacgggctcttcctgctgcgccagtgcctgcgctcgctgggcggctatgtgctgtcgctcgtgcacgatgtgcgcttccaccactttcccatcgagcgccagctcaacggcacctacgccattgccggcggcaaagcgcactgtggaccggcagagctctgcgagttctactcgcgcgaccccgacgggctgccctgcaacctgcgcaagccgtgcaaccggccgtcgggcctcgagccgcagccgggggtcttcgactgcctgcgagacgccatggtgcgtgactacgtgcgccagacgtggaagctggagggcgaggccctggagcaggccatcatcagccaggccccgcaggtggagaagctcattgctacgacggcccacgagcggatgccctggtaccacagcagcctgacgcgtgaggaggccgagcgcaaactttactctggggcgcagaccgacggcaagttcctgctgaggccgcggaaggagcagggcacatacgccctgtccctcatctatgggaagacggtgtaccactacctcatcagccaagacaaggcgggcaagtactgcattcccgagggcaccaagtttgacacgctctggcagctggtggagtatctgaagctgaaggcggacgggctcatctactgcctgaaggaggcctgccccaacagcagtgccagcaacgcctcaggggctgctgctcccacactcccagcccacccatccacgttgactcatcctcagagacgaatcgacaccctcaactcagatggatacacccctgagccagcacgcataacgtccccagacaaaccgcggccgatgcccatggacacgagcgtgtatgagagcccctacagcgacccagaggagctcaaggacaagaagctcttcctgaagcgcgataacctcctcatagctgacattgaacttggctgcggcaactttggctcagtgcgccagggcgtgtaccgcatgcgcaagaagcagatcgacgtggccatcaaggtgctgaagcagggcacggagaaggcagacacggaagagatgatgcgcgaggcgcagatcatgcaccagctggacaacccctacatcgtgcggctcattggcgtctgccaggccgaggccctcatgctggtcatggagatggctgggggcgggccgctgcacaagttcctggtcggcaagagggaggagatccctgtgagcaatgtggccgagctgctgcaccaggtgtccatggggatgaagtacctggaggagaagaactttgtgcaccgtgacctggcggcccgcaacgtcctgctggttaaccggcactacgccaagatcagcgactttggcctctccaaagcactgggtgccgacgacagctactacactgcccgctcagcagggaagtggccgctcaagtggtacgcacccgaatgcatcaacttccgcaagttctccagccgcagcgatgtctggagctatggggtcaccatgtgggaggccttgtcctacggccagaagccctacaagaagatgaaagggccggaggtcatggccttcatcgagcagggcaagcggatggaatgcccaccagagtgtccacccgaactgtacgcactcatgagtgactgctggatctacaagtgggaggatcgccccgacttcctgaccgtggagcagcgcatgcgagcctgttactacagcctggccagcaaggtggaagggcccccaggcagcacacagaaggctgaggctgcctgtgcctga
Sequence Length
1860
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,873 Da
NCBI Official Full Name
Homo sapiens zeta-chain (TCR) associated protein kinase 70kDa, mRNA
NCBI Official Synonym Full Names
zeta chain of T cell receptor associated protein kinase 70
NCBI Official Symbol
ZAP70
NCBI Official Synonym Symbols
SRK; STD; TZK; STCD; IMD48; ADMIO2; ZAP-70
NCBI Protein Information
tyrosine-protein kinase ZAP-70
UniProt Protein Name
Tyrosine-protein kinase ZAP-70
Protein Family
UniProt Gene Name
ZAP70
UniProt Synonym Gene Names
SRK
UniProt Entry Name
ZAP70_HUMAN

NCBI Description

This gene encodes an enzyme belonging to the protein tyrosine kinase family, and it plays a role in T-cell development and lymphocyte activation. This enzyme, which is phosphorylated on tyrosine residues upon T-cell antigen receptor (TCR) stimulation, functions in the initial step of TCR-mediated signal transduction in combination with the Src family kinases, Lck and Fyn. This enzyme is also essential for thymocyte development. Mutations in this gene cause selective T-cell defect, a severe combined immunodeficiency disease characterized by a selective absence of CD8-positive T-cells. Two transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

ZAP70: a tyrosine kinase of the Syk family. Associates with the T-cell antigen receptor zeta-chain after TCR stimulation. Phosphorylated by Src-family kinases following antigen receptor activation. Plays a role in lymphocyte activation.

Protein type: Kinase, protein; Protein kinase, TK; Protein kinase, tyrosine (non-receptor); EC 2.7.10.2; TK group; Syk family

Chromosomal Location of Human Ortholog: 2q12

Cellular Component: cytoplasm; cytosol; extrinsic to internal side of plasma membrane; lipid raft; plasma membrane; T cell receptor complex

Molecular Function: non-membrane spanning protein tyrosine kinase activity; protein binding; protein-tyrosine kinase activity; receptor binding

Biological Process: adaptive immune response; B cell activation; B cell receptor signaling pathway; immune response; inflammatory response; innate immune response; macrophage activation during immune response; neutrophil activation during immune response; peptidyl-tyrosine phosphorylation; positive regulation of alpha-beta T cell proliferation; positive regulation of B cell differentiation; positive regulation of cell adhesion mediated by integrin; positive regulation of mast cell degranulation; positive regulation of T cell differentiation; positive thymic T cell selection; protein amino acid phosphorylation; T cell activation; T cell receptor signaling pathway; transmembrane receptor protein tyrosine kinase signaling pathway

Disease: Autoimmune Disease, Multisystem, Infantile-onset, 2; Selective T-cell Defect

Research Articles on ZAP70

Similar Products

Product Notes

The ZAP70 zap70 (Catalog #AAA1275414) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccagacc ccgcggcgca cctgcccttc ttctacggca gcatctcgcg tgccgaggcc gaggagcacc tgaagctggc gggcatggcg gacgggctct tcctgctgcg ccagtgcctg cgctcgctgg gcggctatgt gctgtcgctc gtgcacgatg tgcgcttcca ccactttccc atcgagcgcc agctcaacgg cacctacgcc attgccggcg gcaaagcgca ctgtggaccg gcagagctct gcgagttcta ctcgcgcgac cccgacgggc tgccctgcaa cctgcgcaag ccgtgcaacc ggccgtcggg cctcgagccg cagccggggg tcttcgactg cctgcgagac gccatggtgc gtgactacgt gcgccagacg tggaagctgg agggcgaggc cctggagcag gccatcatca gccaggcccc gcaggtggag aagctcattg ctacgacggc ccacgagcgg atgccctggt accacagcag cctgacgcgt gaggaggccg agcgcaaact ttactctggg gcgcagaccg acggcaagtt cctgctgagg ccgcggaagg agcagggcac atacgccctg tccctcatct atgggaagac ggtgtaccac tacctcatca gccaagacaa ggcgggcaag tactgcattc ccgagggcac caagtttgac acgctctggc agctggtgga gtatctgaag ctgaaggcgg acgggctcat ctactgcctg aaggaggcct gccccaacag cagtgccagc aacgcctcag gggctgctgc tcccacactc ccagcccacc catccacgtt gactcatcct cagagacgaa tcgacaccct caactcagat ggatacaccc ctgagccagc acgcataacg tccccagaca aaccgcggcc gatgcccatg gacacgagcg tgtatgagag cccctacagc gacccagagg agctcaagga caagaagctc ttcctgaagc gcgataacct cctcatagct gacattgaac ttggctgcgg caactttggc tcagtgcgcc agggcgtgta ccgcatgcgc aagaagcaga tcgacgtggc catcaaggtg ctgaagcagg gcacggagaa ggcagacacg gaagagatga tgcgcgaggc gcagatcatg caccagctgg acaaccccta catcgtgcgg ctcattggcg tctgccaggc cgaggccctc atgctggtca tggagatggc tgggggcggg ccgctgcaca agttcctggt cggcaagagg gaggagatcc ctgtgagcaa tgtggccgag ctgctgcacc aggtgtccat ggggatgaag tacctggagg agaagaactt tgtgcaccgt gacctggcgg cccgcaacgt cctgctggtt aaccggcact acgccaagat cagcgacttt ggcctctcca aagcactggg tgccgacgac agctactaca ctgcccgctc agcagggaag tggccgctca agtggtacgc acccgaatgc atcaacttcc gcaagttctc cagccgcagc gatgtctgga gctatggggt caccatgtgg gaggccttgt cctacggcca gaagccctac aagaagatga aagggccgga ggtcatggcc ttcatcgagc agggcaagcg gatggaatgc ccaccagagt gtccacccga actgtacgca ctcatgagtg actgctggat ctacaagtgg gaggatcgcc ccgacttcct gaccgtggag cagcgcatgc gagcctgtta ctacagcctg gccagcaagg tggaagggcc cccaggcagc acacagaagg ctgaggctgc ctgtgcctga. It is sometimes possible for the material contained within the vial of "ZAP70, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.