Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

YKT6 cdna clone

YKT6 cDNA Clone

Synonyms
YKT6; YKT6 cDNA Clone; YKT6 cdna clone
Ordering
For Research Use Only!
Sequence
atgaagctgtacagcctcagcgtcctctacaaaggcgaggccaaggtggtgctgctcaaagccgcatacgatgtgtcttccttcagctttttccagagatccagcgttcaggaattcatgaccttcacgagtcaactgattgtggagcgctcatcgaaaggcactagagcttctgtcaaagaacaagactatctgtgccacgtctacgtccggaatgatagtcttgcaggtgtggtcattgctgacaatgaatacccatcccgggtggcctttaccttgctggagaaggtactagatgaattctccaagcaagtcgacaggatagactggccagtaggatcccctgctacaatccattacccagccctggatggtcacctcagtagataccagaacccacgagaagctgatcccatgactaaagtgcaggccgaactagatgagaccaaaatcattctgcacaacaccatggagtctctgttagagcgaggtgagaagctagatgacttggtgtccaaatccgaggtgctgggaacacagtctaaagccttctataaaactgcccggaaacaaaactcatgctgtgccatcatgtga
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,580 Da
NCBI Official Full Name
Homo sapiens YKT6 v-SNARE homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
YKT6 v-SNARE homolog (S. cerevisiae)
NCBI Official Symbol
YKT6
NCBI Protein Information
synaptobrevin homolog YKT6
UniProt Protein Name
Synaptobrevin homolog YKT6
Protein Family
UniProt Gene Name
YKT6
UniProt Entry Name
YKT6_HUMAN

NCBI Description

This gene product is one of the SNARE recognition molecules implicated in vesicular transport between secretory compartments. It is a membrane associated, isoprenylated protein that functions at the endoplasmic reticulum-Golgi transport step. This protein is highly conserved from yeast to human and can functionally complement the loss of the yeast homolog in the yeast secretory pathway. [provided by RefSeq, Jul 2008]

Uniprot Description

YKT6: Vesicular soluble NSF attachment protein receptor (v- SNARE) mediating vesicle docking and fusion to a specific acceptor cellular compartment. Functions in endoplasmic reticulum to Golgi transport; as part of a SNARE complex composed of GOSR1, GOSR2 and STX5. Functions in early/recycling endosome to TGN transport; as part of a SNARE complex composed of BET1L, GOSR1 and STX5. Has a S-palmitoyl transferase activity. Belongs to the synaptobrevin family.

Protein type: Vesicle; Membrane protein, integral; Endoplasmic reticulum; Transferase; EC 2.3.1.-

Chromosomal Location of Human Ortholog: 7p15.1

Cellular Component: cell-cell adherens junction; cytoplasm; endoplasmic reticulum; endosome; ER-Golgi intermediate compartment membrane; Golgi apparatus; Golgi membrane; integral to plasma membrane; mitochondrion; SNARE complex; transport vesicle

Molecular Function: protein-cysteine S-palmitoleyltransferase activity; SNAP receptor activity; SNARE binding

Biological Process: ER to Golgi vesicle-mediated transport; retrograde transport, endosome to Golgi; vesicle docking during exocytosis; vesicle fusion; vesicle targeting

Research Articles on YKT6

Similar Products

Product Notes

The YKT6 ykt6 (Catalog #AAA1271205) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctgt acagcctcag cgtcctctac aaaggcgagg ccaaggtggt gctgctcaaa gccgcatacg atgtgtcttc cttcagcttt ttccagagat ccagcgttca ggaattcatg accttcacga gtcaactgat tgtggagcgc tcatcgaaag gcactagagc ttctgtcaaa gaacaagact atctgtgcca cgtctacgtc cggaatgata gtcttgcagg tgtggtcatt gctgacaatg aatacccatc ccgggtggcc tttaccttgc tggagaaggt actagatgaa ttctccaagc aagtcgacag gatagactgg ccagtaggat cccctgctac aatccattac ccagccctgg atggtcacct cagtagatac cagaacccac gagaagctga tcccatgact aaagtgcagg ccgaactaga tgagaccaaa atcattctgc acaacaccat ggagtctctg ttagagcgag gtgagaagct agatgacttg gtgtccaaat ccgaggtgct gggaacacag tctaaagcct tctataaaac tgcccggaaa caaaactcat gctgtgccat catgtga. It is sometimes possible for the material contained within the vial of "YKT6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.