Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

YARS cdna clone

YARS cDNA Clone

Gene Names
YARS; YRS; YTS; TYRRS; CMTDIC
Synonyms
YARS; YARS cDNA Clone; YARS cdna clone
Ordering
For Research Use Only!
Sequence
atgggggacgctcccagccctgaagagaaactgcaccttatcacccggaacctgcaggaggttctgggggaagagaagctgaaggagatactgaaggagcgggaacttaaaatttactggggaacggcaaccacgggcaaaccacatgtggcttactttgtgcccatgtcaaagattgcagacttcttaaaggcagggtgtgaggtaacaattctgtttgcggacctccacgcatacctggataacatgaaagccccatgggaacttctagaactccgagtcagttactatgagaatgtgatcaaagcaatgctggagagcattggtgtgcccttggagaagctcaagttcatcaaaggcactgattaccagctcagcaaagagtacacactagatgtgtacagactctcctccgtggtcacacagcacgattccaagaaggctggagctgaggtggtaaagcaggtggagcaccctttgctgagtggcctcttataccccggactgcaggctttggatgaagagtatttaaaagtagatgcccaatttggaggcattgatcagagaaagattttcacctttgcagagaagtacctccctgcacttggctattcaaaacgggtccatctgatgaatcctatggttccaggattaacaggcagcaaaatgagctcttcagaagaggagtccaagattgatctccttgatcggaaggaggatgtgaagaaaaaactgaagaaggccttctgtgagccaggaaatgtggagaacaatggggttctgtccttcatcaagcatgtcctttttccccttaagtccgagtttgtgatcctacgagatgagaaatggggtggaaacaaaacctacacagcttacgtggacctggaaaaggactttgctgctgaggttgtacatcctggagacctgaagaattctgttgaagtcgcactgaacaagttgctggatccaatccgggaaaagtttaatacccctgccctgaaaaaactggccagcgctgcctacccagatccctcaaagcagaagccaatggccaaaggccctgccaagaattcagaaccagaggaggtcatcccatcccggctggatatccgtgtggggaaaatcatcactgtggagaagcacccagatgcagacagcctgtatgtagagaagattgacgtgggggaagctgaaccacggactgtggtgagcggcctggtacagttcgtgcccaaggaggaactgcaggacaggctggtagtggtgctgtgcaacctgaaaccccagaagatgagaggagtcgagtcccaaggcatgcttctgtgtgcttctatagaagggataaaccgccaggttgaacctctggaccctccggcaggctctgctcctggtgagcacgtgtttgtgaagggctatgaaaagggccaaccagatgaggagctcaagcccaagaagaaagtcttcgagaagttgcaggctgacttcaaaatttctgaggagtgcatcgcacagtggaagcaaaccaacttcatgaccaagctgggctccatttcctgtaaatcgctgaaaggggggaacattagctag
Sequence Length
1587
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
59,143 Da
NCBI Official Full Name
Homo sapiens tyrosyl-tRNA synthetase, mRNA
NCBI Official Synonym Full Names
tyrosyl-tRNA synthetase
NCBI Official Symbol
YARS
NCBI Official Synonym Symbols
YRS; YTS; TYRRS; CMTDIC
NCBI Protein Information
tyrosine--tRNA ligase, cytoplasmic
UniProt Protein Name
Tyrosine--tRNA ligase, cytoplasmic
Protein Family
UniProt Gene Name
YARS
UniProt Synonym Gene Names
TyrRS
UniProt Entry Name
SYYC_HUMAN

NCBI Description

Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Tyrosyl-tRNA synthetase belongs to the class I tRNA synthetase family. Cytokine activities have also been observed for the human tyrosyl-tRNA synthetase, after it is split into two parts, an N-terminal fragment that harbors the catalytic site and a C-terminal fragment found only in the mammalian enzyme. The N-terminal fragment is an interleukin-8-like cytokine, whereas the released C-terminal fragment is an EMAP II-like cytokine. [provided by RefSeq, Jul 2008]

Uniprot Description

YARS: Catalyzes the attachment of tyrosine to tRNA(Tyr) in a two-step reaction: tyrosine is first activated by ATP to form Tyr- AMP and then transferred to the acceptor end of tRNA(Tyr). Defects in YARS are the cause of Charcot-Marie-Tooth disease dominant intermediate type C (CMTDIC). CMTDIC is a form of Charcot-Marie-Tooth disease characterized by clinical and pathologic features intermediate between demyelinating and axonal peripheral neuropathies, and motor median nerve conduction velocities ranging from 25 to 45 m/sec. Belongs to the class-I aminoacyl-tRNA synthetase family.

Protein type: Ligase; EC 6.1.1.1

Chromosomal Location of Human Ortholog: 1p35.1

Cellular Component: cytoplasm; cytosol; extracellular space; nucleus

Molecular Function: interleukin-8 receptor binding; protein binding; tyrosine-tRNA ligase activity; valine-tRNA ligase activity

Biological Process: apoptosis; tRNA aminoacylation for protein translation; valyl-tRNA aminoacylation

Disease: Charcot-marie-tooth Disease, Dominant Intermediate C

Research Articles on YARS

Similar Products

Product Notes

The YARS yars (Catalog #AAA1277708) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggacg ctcccagccc tgaagagaaa ctgcacctta tcacccggaa cctgcaggag gttctggggg aagagaagct gaaggagata ctgaaggagc gggaacttaa aatttactgg ggaacggcaa ccacgggcaa accacatgtg gcttactttg tgcccatgtc aaagattgca gacttcttaa aggcagggtg tgaggtaaca attctgtttg cggacctcca cgcatacctg gataacatga aagccccatg ggaacttcta gaactccgag tcagttacta tgagaatgtg atcaaagcaa tgctggagag cattggtgtg cccttggaga agctcaagtt catcaaaggc actgattacc agctcagcaa agagtacaca ctagatgtgt acagactctc ctccgtggtc acacagcacg attccaagaa ggctggagct gaggtggtaa agcaggtgga gcaccctttg ctgagtggcc tcttataccc cggactgcag gctttggatg aagagtattt aaaagtagat gcccaatttg gaggcattga tcagagaaag attttcacct ttgcagagaa gtacctccct gcacttggct attcaaaacg ggtccatctg atgaatccta tggttccagg attaacaggc agcaaaatga gctcttcaga agaggagtcc aagattgatc tccttgatcg gaaggaggat gtgaagaaaa aactgaagaa ggccttctgt gagccaggaa atgtggagaa caatggggtt ctgtccttca tcaagcatgt cctttttccc cttaagtccg agtttgtgat cctacgagat gagaaatggg gtggaaacaa aacctacaca gcttacgtgg acctggaaaa ggactttgct gctgaggttg tacatcctgg agacctgaag aattctgttg aagtcgcact gaacaagttg ctggatccaa tccgggaaaa gtttaatacc cctgccctga aaaaactggc cagcgctgcc tacccagatc cctcaaagca gaagccaatg gccaaaggcc ctgccaagaa ttcagaacca gaggaggtca tcccatcccg gctggatatc cgtgtgggga aaatcatcac tgtggagaag cacccagatg cagacagcct gtatgtagag aagattgacg tgggggaagc tgaaccacgg actgtggtga gcggcctggt acagttcgtg cccaaggagg aactgcagga caggctggta gtggtgctgt gcaacctgaa accccagaag atgagaggag tcgagtccca aggcatgctt ctgtgtgctt ctatagaagg gataaaccgc caggttgaac ctctggaccc tccggcaggc tctgctcctg gtgagcacgt gtttgtgaag ggctatgaaa agggccaacc agatgaggag ctcaagccca agaagaaagt cttcgagaag ttgcaggctg acttcaaaat ttctgaggag tgcatcgcac agtggaagca aaccaacttc atgaccaagc tgggctccat ttcctgtaaa tcgctgaaag gggggaacat tagctag. It is sometimes possible for the material contained within the vial of "YARS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.