XKR8 cdna clone
XKR8 cDNA Clone
Gene Names
XKR8; XRG8; hXkr8
Synonyms
XKR8; XKR8 cDNA Clone; XKR8 cdna clone
Sequence
atgccctggtcgtcccgcggcgccctccttcgggacctggtcctgggcgtgctgggcaccgccgccttcctgctcgacctgggcaccgacctgtgggccgccgtccagtatgcgctcggcggccgctacctgtgggcggcgctggtgctggcgctgctgggcctggcctccgtggcgctgcagctcttcagctggctctggctgcgcgctgaccctgccggcctgcacgggtcgcagcccccgcgccgctgcctggcgctgctgcatctcctgcagctgggttacctgtacaggtgcgtgcaggagctgcggcaggggctgctggtgtggcagcaggaggagccctctgagtttgacttggcctacgccgacttcctcgccctggacatcagcatgctgcggctcttcgagaccttcttggagacggcaccacagctcacgctggtgctggccatcatgctgcagagtggccgggctgagtactaccagtgggttggcatctgcacatccttcctgggcatctcgtgggcactgctcgactaccaccgggccttgcgcacctgcctcccctccaagccgctcctgggcctgggctcctccgtgatctacttcctgtggaacctgctgctgctgtggccccgagtcctggctgtggccctgttctcagccctcttccccagctatgtggccctgcacttcctgggcctgtggctggtactgctgctctgggtctggcttcagggcacagacttcatgccggaccccagctccgagtggctgtaccgggtgacggtggccaccatcctctatttctcctggttcaacgtggctgagggccgcacccgaggccgggccatcatccacttcgccttcctcctgagtgacagcattctcctggtggccacctgggtgactcatagctcctggctgcccagcgggattccactgcagctgtggctgcctgtgggatgcggctgcttctttctgggcctggctctgcggcttgtgtactaccactggctgcaccctagctgctgctggaagcccgaccctgaccaggtagacggggcccggagtctgctttctccagaggggtatcagctgcctcagaacaggcgcatgacccatttagcacagaagtttttccccaaggctaaggatgaggctgcttcgccagtgaagggatag
Sequence Length
1188
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
44,655 Da
NCBI Official Full Name
Homo sapiens XK, Kell blood group complex subunit-related family, member 8, mRNA
NCBI Official Synonym Full Names
XK related 8
NCBI Official Symbol
XKR8
NCBI Official Synonym Symbols
XRG8; hXkr8
NCBI Protein Information
XK-related protein 8
UniProt Protein Name
XK-related protein 8
Protein Family
UniProt Gene Name
XKR8
UniProt Synonym Gene Names
XRG8; hXkr8
UniProt Entry Name
XKR8_HUMAN
Uniprot Description
XKR8: Belongs to the XK family.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 1p35.3
Cellular Component: plasma membrane
Biological Process: engulfment of apoptotic cell
Research Articles on XKR8
Similar Products
Product Notes
The XKR8 xkr8 (Catalog #AAA1270620) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccctggt cgtcccgcgg cgccctcctt cgggacctgg tcctgggcgt gctgggcacc gccgccttcc tgctcgacct gggcaccgac ctgtgggccg ccgtccagta tgcgctcggc ggccgctacc tgtgggcggc gctggtgctg gcgctgctgg gcctggcctc cgtggcgctg cagctcttca gctggctctg gctgcgcgct gaccctgccg gcctgcacgg gtcgcagccc ccgcgccgct gcctggcgct gctgcatctc ctgcagctgg gttacctgta caggtgcgtg caggagctgc ggcaggggct gctggtgtgg cagcaggagg agccctctga gtttgacttg gcctacgccg acttcctcgc cctggacatc agcatgctgc ggctcttcga gaccttcttg gagacggcac cacagctcac gctggtgctg gccatcatgc tgcagagtgg ccgggctgag tactaccagt gggttggcat ctgcacatcc ttcctgggca tctcgtgggc actgctcgac taccaccggg ccttgcgcac ctgcctcccc tccaagccgc tcctgggcct gggctcctcc gtgatctact tcctgtggaa cctgctgctg ctgtggcccc gagtcctggc tgtggccctg ttctcagccc tcttccccag ctatgtggcc ctgcacttcc tgggcctgtg gctggtactg ctgctctggg tctggcttca gggcacagac ttcatgccgg accccagctc cgagtggctg taccgggtga cggtggccac catcctctat ttctcctggt tcaacgtggc tgagggccgc acccgaggcc gggccatcat ccacttcgcc ttcctcctga gtgacagcat tctcctggtg gccacctggg tgactcatag ctcctggctg cccagcggga ttccactgca gctgtggctg cctgtgggat gcggctgctt ctttctgggc ctggctctgc ggcttgtgta ctaccactgg ctgcacccta gctgctgctg gaagcccgac cctgaccagg tagacggggc ccggagtctg ctttctccag aggggtatca gctgcctcag aacaggcgca tgacccattt agcacagaag tttttcccca aggctaagga tgaggctgct tcgccagtga agggatag. It is sometimes possible for the material contained within the vial of "XKR8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
