Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XKR3 cdna clone

XKR3 cDNA Clone

Gene Names
XKR3; XRG3; XTES
Synonyms
XKR3; XKR3 cDNA Clone; XKR3 cdna clone
Ordering
For Research Use Only!
Sequence
atggagacagtgtttgaagagatggatgaagaaagcacaggaggagtttcatcttcgaaagaagaaatagtccttggccagagactccatctaagctttccttttagcattatcttctcaactgttctctactgtggtgaggttgcctttggtttatacatgtttgaaatttatcgaaaagctaatgacacattctggatgtcatttaccatcagctttattattgtgggggcaattttggatcaaattatcctgatgtttttcaacaaagacttgaggagaaataaggctgcattacttttttggcacattcttcttttaggacctattgtgaggtgtttgcacaccattagaaattaccacaaatggttgaaaaatcttaaacaggagaaggaagagactcaagttagcatcacaaagagaaacacgatgctggaaagggagattgcattctcaatccgggataatttcatgcagcagaaggctttcaagtacatgtcagtgattcaggcttttctcggttctgttccacaattaattttgcagatgtatatcagtctcactatacgagaatggcctttgaatagagcattgctgatgacattttccctgttatcagttacttatggggccattcgctgcaatatactggccatccagatcagcaatgatgatactaccattaagctaccgccgatagaattcttctgtgtcgtgatgtggcgttttttggaggttatctcacgtgtagtgactctggcattgttcattgcatctctgaaactgaagagcctacccgttttgttaatcatatattttgtatcattgttggcaccgtggctggagttttggaaaagtggagctcatcttcctggcaacaaagaaaataattccaatatggtgggtacagtactgatgcttttcttgatcacactgctatatgctgccatcaacttctcctgctggtcagcagtgaaactgcagttgtcagatgacaaaataattgacgggagacagaggtggggccatagaatcctacactacagctttcagttttttagaaaatgtgataatgatattggtatttag
Sequence Length
1089
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,448 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:5273312, containing frame-shift errors
NCBI Official Synonym Full Names
XK related 3
NCBI Official Symbol
XKR3
NCBI Official Synonym Symbols
XRG3; XTES
NCBI Protein Information
XK-related protein 3
UniProt Protein Name
XK-related protein 3
Protein Family
UniProt Gene Name
XKR3
UniProt Synonym Gene Names
XRG3
UniProt Entry Name
XKR3_HUMAN

NCBI Description

XKRX (MIM 300684) and XKR3 are homologs of the Kell blood group precursor XK (MIM 314850), which is a putative membrane transporter and a component of the XK/Kell complex of the Kell blood group system (Calenda et al., 2006 [PubMed 16431037]).[supplied by OMIM, Mar 2008]

Uniprot Description

XKR3: Belongs to the XK family

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 22q11.1

Research Articles on XKR3

Similar Products

Product Notes

The XKR3 xkr3 (Catalog #AAA1272067) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagacag tgtttgaaga gatggatgaa gaaagcacag gaggagtttc atcttcgaaa gaagaaatag tccttggcca gagactccat ctaagctttc cttttagcat tatcttctca actgttctct actgtggtga ggttgccttt ggtttataca tgtttgaaat ttatcgaaaa gctaatgaca cattctggat gtcatttacc atcagcttta ttattgtggg ggcaattttg gatcaaatta tcctgatgtt tttcaacaaa gacttgagga gaaataaggc tgcattactt ttttggcaca ttcttctttt aggacctatt gtgaggtgtt tgcacaccat tagaaattac cacaaatggt tgaaaaatct taaacaggag aaggaagaga ctcaagttag catcacaaag agaaacacga tgctggaaag ggagattgca ttctcaatcc gggataattt catgcagcag aaggctttca agtacatgtc agtgattcag gcttttctcg gttctgttcc acaattaatt ttgcagatgt atatcagtct cactatacga gaatggcctt tgaatagagc attgctgatg acattttccc tgttatcagt tacttatggg gccattcgct gcaatatact ggccatccag atcagcaatg atgatactac cattaagcta ccgccgatag aattcttctg tgtcgtgatg tggcgttttt tggaggttat ctcacgtgta gtgactctgg cattgttcat tgcatctctg aaactgaaga gcctacccgt tttgttaatc atatattttg tatcattgtt ggcaccgtgg ctggagtttt ggaaaagtgg agctcatctt cctggcaaca aagaaaataa ttccaatatg gtgggtacag tactgatgct tttcttgatc acactgctat atgctgccat caacttctcc tgctggtcag cagtgaaact gcagttgtca gatgacaaaa taattgacgg gagacagagg tggggccata gaatcctaca ctacagcttt cagtttttta gaaaatgtga taatgatatt ggtatttag. It is sometimes possible for the material contained within the vial of "XKR3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.