Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XCL2 cdna clone

XCL2 cDNA Clone

Gene Names
XCL2; SCM1B; SCYC2; SCM-1b
Synonyms
XCL2; XCL2 cDNA Clone; XCL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagacttctcatcctggccctccttggcatctgctctctcactgcatacattgtggaaggtgtagggagtgaagtctcacataggaggacctgtgtgagcctcactacccagcgactgccagttagcagaatcaagacctacaccatcacggaaggctccttgagagcagtaatttttattaccaaacgtggcctaaaagtctgtgctgatccacaagccacgtgggtgagagacgtggtcaggagcatggacaggaaatccaacaccagaaataacatgatccagaccaagccaacaggaacccagcaatcgaccaatacagctgtgaccctgactggctag
Sequence Length
345
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,567 Da
NCBI Official Full Name
Homo sapiens chemokine (C motif) ligand 2, mRNA
NCBI Official Synonym Full Names
X-C motif chemokine ligand 2
NCBI Official Symbol
XCL2
NCBI Official Synonym Symbols
SCM1B; SCYC2; SCM-1b
NCBI Protein Information
cytokine SCM-1 beta
UniProt Protein Name
Cytokine SCM-1 beta
Protein Family
UniProt Gene Name
XCL2
UniProt Synonym Gene Names
SCYC2
UniProt Entry Name
XCL2_HUMAN

Uniprot Description

XCL2: Chemotactic activity for lymphocytes but not for monocytes or neutrophils. Belongs to the intercrine gamma family.

Protein type: Secreted; Motility/polarity/chemotaxis; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1q24.2

Cellular Component: extracellular region; extracellular space

Molecular Function: CCR chemokine receptor binding; protein binding

Biological Process: blood circulation; G-protein coupled receptor protein signaling pathway; inflammatory response; lymphocyte chemotaxis; monocyte chemotaxis; neutrophil chemotaxis; positive regulation of GTPase activity; positive regulation of inflammatory response; signal transduction

Research Articles on XCL2

Similar Products

Product Notes

The XCL2 xcl2 (Catalog #AAA1269156) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagacttc tcatcctggc cctccttggc atctgctctc tcactgcata cattgtggaa ggtgtaggga gtgaagtctc acataggagg acctgtgtga gcctcactac ccagcgactg ccagttagca gaatcaagac ctacaccatc acggaaggct ccttgagagc agtaattttt attaccaaac gtggcctaaa agtctgtgct gatccacaag ccacgtgggt gagagacgtg gtcaggagca tggacaggaa atccaacacc agaaataaca tgatccagac caagccaaca ggaacccagc aatcgaccaa tacagctgtg accctgactg gctag. It is sometimes possible for the material contained within the vial of "XCL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.