Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WWP2 cdna clone

WWP2 cDNA Clone

Gene Names
WWP2; AIP2; WWp2-like
Synonyms
WWP2; WWP2 cDNA Clone; WWP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcatctgccagctctagccgggcaggagtggccctgccttttgagaagtctcagctcactttgaaagtggtgtccgcaaagcccaaggtgcataatcgtcaacctcgaattaactcctacgtggaggtggcggtggatggactccccagtgagaccaagaagactgggaagcgcattgggagctctgagcttctctggaatgagatcatcattttgaatgtcacggcacagagtcatttagatttaaaggtctggagctgccataccttgagaaatgaactgctaggcaccgcatctgtcaacctctccaacgtcttgaagaacaatgggggcaaaatggagaacatgcagctgaccctgaacctgcagacggagaacaaaggcagcgttgtctcaggcggagagctgacaattttcctggacgggccaactgttgatctgggaaatgtgcctaatggcagtgccctgacagatggatcacagctgccttcgagagactccagtggaacagcagtagctccagagaaccggcaccagccccccagcacaaactgctttggtggaagatcccggacgcacagacattcgggtgcttcagccagaacaaccccagcaaccggcgagcaaagccccggtgctcggagccggcaccgccagcccgtcaagaactcaggccacagtggcttggccaatggcacagtgaatgatgaacccacaacagccactgatcccgaagaaccttccgttgttggtgtgacgtccccacctgctgcacccttgagtgtgaccccgaatcccaacacgacttctctccctgccccagccacaccggctgaaggagaggaacccagcacttcgggtacacagcagctcccagcggctgcccaggcccccgacgctctgcctgctggatgggaacagcgagagctgcccaacggacgtgtctattatgttgaccacaataccaagaccaccacctgggagcggccccttcctccagggtag
Sequence Length
1008
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,248 Da
NCBI Official Full Name
Homo sapiens WW domain containing E3 ubiquitin protein ligase 2, mRNA
NCBI Official Synonym Full Names
WW domain containing E3 ubiquitin protein ligase 2
NCBI Official Symbol
WWP2
NCBI Official Synonym Symbols
AIP2; WWp2-like
NCBI Protein Information
NEDD4-like E3 ubiquitin-protein ligase WWP2
UniProt Protein Name
NEDD4-like E3 ubiquitin-protein ligase WWP2
UniProt Gene Name
WWP2
UniProt Synonym Gene Names
AIP2
UniProt Entry Name
WWP2_HUMAN

NCBI Description

This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]

Uniprot Description

WWP2: E3 ubiquitin-protein ligase which accepts ubiquitin from an E2 ubiquitin-conjugating enzyme in the form of a thioester and then directly transfers the ubiquitin to targeted substrates. Polyubiquitinates POU5F1 by 'Lys-63'-linked conjugation and promotes it to proteasomal degradation; in embryonic stem cells (ESCs) the ubiquitination is proposed to regulate POU5F1 protein level. Ubiquitinates EGR2 and promotes it to proteasomal degradation; in T-cells the ubiquitination inhibits activation- induced cell death. Ubiquitinates SLC11A2; the ubiquitination is enhanced by presence of NDFIP1 and NDFIP2. Ubiquitinates RPB1 and promotes it to proteasomal degradation.

Protein type: EC 6.3.2.19; Ligase; Ubiquitin conjugating system; Ubiquitin ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: cytoplasm; membrane; nucleus; ubiquitin ligase complex

Molecular Function: protein binding; transcription factor binding; ubiquitin-protein ligase activity

Biological Process: entry of virus into host cell; negative regulation of protein transport; negative regulation of transcription factor activity; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent; negative regulation of transporter activity; proteasomal ubiquitin-dependent protein catabolic process; protein autoubiquitination; protein modification process; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of membrane potential

Research Articles on WWP2

Similar Products

Product Notes

The WWP2 wwp2 (Catalog #AAA1275623) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcatctg ccagctctag ccgggcagga gtggccctgc cttttgagaa gtctcagctc actttgaaag tggtgtccgc aaagcccaag gtgcataatc gtcaacctcg aattaactcc tacgtggagg tggcggtgga tggactcccc agtgagacca agaagactgg gaagcgcatt gggagctctg agcttctctg gaatgagatc atcattttga atgtcacggc acagagtcat ttagatttaa aggtctggag ctgccatacc ttgagaaatg aactgctagg caccgcatct gtcaacctct ccaacgtctt gaagaacaat gggggcaaaa tggagaacat gcagctgacc ctgaacctgc agacggagaa caaaggcagc gttgtctcag gcggagagct gacaattttc ctggacgggc caactgttga tctgggaaat gtgcctaatg gcagtgccct gacagatgga tcacagctgc cttcgagaga ctccagtgga acagcagtag ctccagagaa ccggcaccag ccccccagca caaactgctt tggtggaaga tcccggacgc acagacattc gggtgcttca gccagaacaa ccccagcaac cggcgagcaa agccccggtg ctcggagccg gcaccgccag cccgtcaaga actcaggcca cagtggcttg gccaatggca cagtgaatga tgaacccaca acagccactg atcccgaaga accttccgtt gttggtgtga cgtccccacc tgctgcaccc ttgagtgtga ccccgaatcc caacacgact tctctccctg ccccagccac accggctgaa ggagaggaac ccagcacttc gggtacacag cagctcccag cggctgccca ggcccccgac gctctgcctg ctggatggga acagcgagag ctgcccaacg gacgtgtcta ttatgttgac cacaatacca agaccaccac ctgggagcgg ccccttcctc cagggtag. It is sometimes possible for the material contained within the vial of "WWP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.