WSCD2 cdna clone
WSCD2 cDNA Clone
Synonyms
WSCD2; WSCD2 cDNA Clone; WSCD2 cdna clone
Sequence
atggacagaaggttcctgccaggcaagtccaagcagctcattgctttggccagcttcccaggtgctggcaacacgtgggctcgccacctcattgaattggccacaggcttctacactggcagctactacttcgatggctccctctacaacaaagggtttaaaggtgagcgggaccactggcgcagcggacggaccatctgcatcaagacgcacgaaagcggccagaaagagatcgaggccttcgacgccgccatcctgctcatccgcaacccctacaaagccctcatggctgagttcaaccgcaagtacggcggccacataggctttgctgcgcatgcccactggaagggcaaaggagccgtaccaggatctttgcaaatcttatttcgctcgatttgcacagcatctgtaggagagtggccagagttcgtgaggaactatgccccgtggtgggccactcacacactggactggctcaagtttggcaagaaggtgctggtggtgcactttgaggacctgaagcaggacctctttgtccagctgggccggatggtcagcctgctgggcgtggctgtcagggaggaccggctgctctgtgtggagagccagaaggatggcaacttcaagcgctcagggctccggaagctcgagtatgacccctatactgcggacatgcagaagaccatctctgcctacatcaagatggtggatgcagccctcaaagggcggaacctaacgggtgtccccgatgactactacccaagatga
Sequence Length
768
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
65,775 Da
NCBI Official Full Name
Homo sapiens WSC domain containing 2, mRNA
NCBI Official Synonym Full Names
WSC domain containing 2
NCBI Official Symbol
WSCD2
NCBI Protein Information
WSC domain-containing protein 2
UniProt Protein Name
WSC domain-containing protein 2
Protein Family
UniProt Gene Name
WSCD2
UniProt Synonym Gene Names
KIAA0789
UniProt Entry Name
WSCD2_HUMAN
Uniprot Description
WSCD2: Belongs to the WSCD family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, integral
Chromosomal Location of Human Ortholog: 12q23.3
Research Articles on WSCD2
Similar Products
Product Notes
The WSCD2 wscd2 (Catalog #AAA1277287) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacagaa ggttcctgcc aggcaagtcc aagcagctca ttgctttggc cagcttccca ggtgctggca acacgtgggc tcgccacctc attgaattgg ccacaggctt ctacactggc agctactact tcgatggctc cctctacaac aaagggttta aaggtgagcg ggaccactgg cgcagcggac ggaccatctg catcaagacg cacgaaagcg gccagaaaga gatcgaggcc ttcgacgccg ccatcctgct catccgcaac ccctacaaag ccctcatggc tgagttcaac cgcaagtacg gcggccacat aggctttgct gcgcatgccc actggaaggg caaaggagcc gtaccaggat ctttgcaaat cttatttcgc tcgatttgca cagcatctgt aggagagtgg ccagagttcg tgaggaacta tgccccgtgg tgggccactc acacactgga ctggctcaag tttggcaaga aggtgctggt ggtgcacttt gaggacctga agcaggacct ctttgtccag ctgggccgga tggtcagcct gctgggcgtg gctgtcaggg aggaccggct gctctgtgtg gagagccaga aggatggcaa cttcaagcgc tcagggctcc ggaagctcga gtatgacccc tatactgcgg acatgcagaa gaccatctct gcctacatca agatggtgga tgcagccctc aaagggcgga acctaacggg tgtccccgat gactactacc caagatga. It is sometimes possible for the material contained within the vial of "WSCD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
