Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WSCD1 cdna clone

WSCD1 cDNA Clone

Synonyms
WSCD1; WSCD1 cDNA Clone; WSCD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaaacctttcttccgactccagaagtttctccgccgaacacagttcctgctgttcttcctcacggctgcctacctgatgaccggcagcctgctgctgctgcagcgggtccgcgtggctctcccacagggcccccgggcacccggccccctgcagaccttgccagtggccgccgtggcgctgggcgtgggcttgctggacagcagagccctgcacgaccctcgagtcagcccagagctgctgctgggtgtggacatgctgcagagccccctgacccggccccggcccggcccccgctggctccggagccgcaactcggagctgcgtcagttgcgtcgccgctggttccaccacttcatgagtgactcccagggaccgcccgccctgggccccgaggctgccaggcccgccatccacagccgaggcacctacattggatgcttcagtgacgatggccacgagaggactctgaaaggagctgtgttttatgacttgagaaagatgactgtctcccactgccaggatgcgtgtgctgagcggtcctatgtctacgccggcttggaggccggggcggagtgttactgcgggaaccggctgccagcggtgagcgtggggctggaagagtgtaactatgagtgcaaaggcgagaagggctctgtgtgcggggctgtggaccggctctccgtgtaccgtgtggacgagctgcagccgggctccaggaagcggcggaccgccacctaccgcggatgcttccgactgccagagaacatcacacatgccttccccagctccctgatacaggccaatgtgaccgtggggacttgctcgggcttttgttcccagaaagagttccccttggccattctcaggggctgggaatgctactgtgcttaccctaccccccggttcaacctgcgggatgccatggacagctcagtatgtggccaggaccctgaggcacagaggctggcagaatactgtgaggtctaccagacacctgtgcaagacactcgttgtacagacaggaggttcctgcctaacaaatccaaagtgtttgtggctttgtcaagcttcccaggagccgggaacacgtgggcacggcacctcattgagcatgccactggcttctatacagggagctactactttgatggaaccctctacaacaaagggttcaagggcgaaaaggaccactggcggagccgacgcaccatctgtgtcaaaacccacgagagtggcaggagggagattgagatgtttgattcagccatcctgctaatccggaacccatacaggtccctggtggcagaattcaacagaaaatgtgccgggcacctgggatatgcagctgaccgcaactggaagagcaaagagtggccggactttgtcaacagctacgcctcgtggtggtcctcgcacgtcctggactggctcaagtacgggaagcggctgctggtggtgcactacgaggagctgcggcgcagcctggtgcccacgttacgggagatggtggccttcctcaacgtgtctgtgagcgaggagcggctgctctgcgtggagaacaacaaggagggcagcttccggcggcgcggccggcgctcccacgaccctgagcccttcaccccggagatgaaagacttgatcaatggctacatccggacggtggaccaagccctgcgtgaccacaactggacggggctgcccagggagtatgtgcccagatga
Sequence Length
1728
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
65,694 Da
NCBI Official Full Name
Homo sapiens WSC domain containing 1, mRNA
NCBI Official Synonym Full Names
WSC domain containing 1
NCBI Official Symbol
WSCD1
NCBI Protein Information
WSC domain-containing protein 1
UniProt Protein Name
WSC domain-containing protein 1
UniProt Gene Name
WSCD1
UniProt Synonym Gene Names
KIAA0523
UniProt Entry Name
WSCD1_HUMAN

Uniprot Description

WSCD1: Belongs to the WSCD family.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 17p13.2

Similar Products

Product Notes

The WSCD1 wscd1 (Catalog #AAA1276432) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaaac ctttcttccg actccagaag tttctccgcc gaacacagtt cctgctgttc ttcctcacgg ctgcctacct gatgaccggc agcctgctgc tgctgcagcg ggtccgcgtg gctctcccac agggcccccg ggcacccggc cccctgcaga ccttgccagt ggccgccgtg gcgctgggcg tgggcttgct ggacagcaga gccctgcacg accctcgagt cagcccagag ctgctgctgg gtgtggacat gctgcagagc cccctgaccc ggccccggcc cggcccccgc tggctccgga gccgcaactc ggagctgcgt cagttgcgtc gccgctggtt ccaccacttc atgagtgact cccagggacc gcccgccctg ggccccgagg ctgccaggcc cgccatccac agccgaggca cctacattgg atgcttcagt gacgatggcc acgagaggac tctgaaagga gctgtgtttt atgacttgag aaagatgact gtctcccact gccaggatgc gtgtgctgag cggtcctatg tctacgccgg cttggaggcc ggggcggagt gttactgcgg gaaccggctg ccagcggtga gcgtggggct ggaagagtgt aactatgagt gcaaaggcga gaagggctct gtgtgcgggg ctgtggaccg gctctccgtg taccgtgtgg acgagctgca gccgggctcc aggaagcggc ggaccgccac ctaccgcgga tgcttccgac tgccagagaa catcacacat gccttcccca gctccctgat acaggccaat gtgaccgtgg ggacttgctc gggcttttgt tcccagaaag agttcccctt ggccattctc aggggctggg aatgctactg tgcttaccct accccccggt tcaacctgcg ggatgccatg gacagctcag tatgtggcca ggaccctgag gcacagaggc tggcagaata ctgtgaggtc taccagacac ctgtgcaaga cactcgttgt acagacagga ggttcctgcc taacaaatcc aaagtgtttg tggctttgtc aagcttccca ggagccggga acacgtgggc acggcacctc attgagcatg ccactggctt ctatacaggg agctactact ttgatggaac cctctacaac aaagggttca agggcgaaaa ggaccactgg cggagccgac gcaccatctg tgtcaaaacc cacgagagtg gcaggaggga gattgagatg tttgattcag ccatcctgct aatccggaac ccatacaggt ccctggtggc agaattcaac agaaaatgtg ccgggcacct gggatatgca gctgaccgca actggaagag caaagagtgg ccggactttg tcaacagcta cgcctcgtgg tggtcctcgc acgtcctgga ctggctcaag tacgggaagc ggctgctggt ggtgcactac gaggagctgc ggcgcagcct ggtgcccacg ttacgggaga tggtggcctt cctcaacgtg tctgtgagcg aggagcggct gctctgcgtg gagaacaaca aggagggcag cttccggcgg cgcggccggc gctcccacga ccctgagccc ttcaccccgg agatgaaaga cttgatcaat ggctacatcc ggacggtgga ccaagccctg cgtgaccaca actggacggg gctgcccagg gagtatgtgc ccagatga. It is sometimes possible for the material contained within the vial of "WSCD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.